Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

2.

rs80356584 [Homo sapiens]
    TCTGGCTCCCCCTTCTCCTGCCTGC[A/G]GGTCAGCATCACGGTGATCGAGGCC
    Chromosome:
    2:26495075
    Gene:
    OTOF (GeneView)
    Functional Consequence:
    splice acceptor variant
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000002.11:g.26717943T>C, NC_000002.12:g.26495075T>C, NG_009937.1:g.68624A>G, NM_001287489.1:c.766-2A>G, NM_194248.2:c.766-2A>G, XM_005264644.1:c.811-2A>G, XM_017005338.1:c.766-2A>G

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center