Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from

Items: 1 to 20 of 231

1.
2.
6.
7.
8.
9.
10.

rs778410218 [Homo sapiens]
    CTCAGACACCATGGGGAAGGTGAAG[A/G]TCGGAGTCAACGGGTGAGTTCGCGG
    Chromosome:
    12:6534848
    Gene:
    GAPDH (GeneView)
    Functional Consequence:
    missense,upstream variant 2KB
    Validated:
    no info
    HGVS:
    NC_000012.11:g.6644014G>A, NC_000012.12:g.6534848G>A, NG_007073.2:g.5358G>A, NM_001256799.2:c.-719G>A, NM_001289745.1:c.16G>A, NM_001289746.1:c.16G>A, NM_002046.5:c.16G>A, NP_001276674.1:p.Val6Ile, NP_001276675.1:p.Val6Ile, NP_002037.2:p.Val6Ile, XM_005253678.1:c.-85G>A
    13.
    15.
    16.

    Display Settings:

    Format
    Items per page
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center