Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 233

5.

rs780860941 [Homo sapiens]
    CCGTGAACTCCTCATCAAAATACCT[A/G]GTGTCAGTCTCCGACGTGACCTGGG
    Chromosome:
    14:104770803
    Gene:
    AKT1 (GeneView)
    Functional Consequence:
    downstream variant 500B,synonymous codon
    Validated:
    no info
    HGVS:
    CM000676.2:g.104770803G>A, NC_000014.8:g.105237140G>A, NC_000014.9:g.104770803G>A, NG_012188.1:g.29942C>T, NM_001014431.1:c.1305C>T, NM_001014432.1:c.1305C>T, NM_005163.2:c.1305C>T, NP_001014431.1:p.Thr435, NP_001014432.1:p.Thr435, NP_005154.2:p.Thr435, XP_005267458.1:p.Thr435, XP_005267459.1:p.Thr434
    12.

    rs779447501 [Homo sapiens]
      CAAAATACCTGGTGTCAGTCTCCGA[C/T]GTGACCTGGGGCTTGAAGGGTGGGC
      Chromosome:
      14:104770818
      Gene:
      AKT1 (GeneView)
      Functional Consequence:
      downstream variant 500B,synonymous codon
      Validated:
      by frequency
      HGVS:
      CM000676.2:g.104770818C>T, NC_000014.8:g.105237155C>T, NC_000014.9:g.104770818C>T, NG_012188.1:g.29927G>A, NM_001014431.1:c.1290G>A, NM_001014432.1:c.1290G>A, NM_005163.2:c.1290G>A, NP_001014431.1:p.Thr430, NP_001014432.1:p.Thr430, NP_005154.2:p.Thr430, XP_005267458.1:p.Thr430, XP_005267459.1:p.Thr429

      Display Settings:

      Format
      Items per page
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center