Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 578

3.

rs781446220 [Homo sapiens]
    CGGCATCCCCAACGGCTACCTGGTC[C/G/T]TAGACCTCAGCATGCAAGGTGGGCG
    Chromosome:
    16:768547
    Gene:
    MIR662 (GeneView) MSLN (GeneView)
    Functional Consequence:
    missense,synonymous codon,upstream variant 2KB
    Validated:
    by frequency
    HGVS:
    NC_000016.10:g.768547C>G, NC_000016.10:g.768547C>T, NC_000016.9:g.818547C>G, NC_000016.9:g.818547C>T, NM_001177355.2:c.1765C>G, NM_001177355.2:c.1765C>T, NM_005823.5:c.1765C>G, NM_005823.5:c.1765C>T, NM_013404.4:c.1789C>G, NM_013404.4:c.1789C>T, NP_001170826.1:p.Leu589, NP_001170826.1:p.Leu589Val, NP_005814.2:p.Leu589, NP_005814.2:p.Leu589Val, NP_037536.2:p.Leu597, NP_037536.2:p.Leu597Val, NR_030384.1:n.-1636C>G, NR_030384.1:n.-1636C>T, XM_005255034.1:c.1762C>G, XM_005255034.1:c.1762C>T, XM_005255034.4:c.1762C>G, XM_005255034.4:c.1762C>T, XM_011522348.2:c.1789C>G, XM_011522348.2:c.1789C>T, XM_017022853.1:c.1819C>G, XM_017022853.1:c.1819C>T, XM_017022854.1:c.1816C>G, XM_017022854.1:c.1816C>T, XM_017022855.1:c.1795C>G, XM_017022855.1:c.1795C>T, XM_017022856.1:c.1792C>G, XM_017022856.1:c.1792C>T, XM_017022857.1:c.1789C>G, XM_017022857.1:c.1789C>T, XM_017022858.1:c.1786C>G, XM_017022858.1:c.1786C>T, XP_005255091.1:p.Leu588, XP_005255091.1:p.Leu588Val, XP_011520650.1:p.Leu597, XP_011520650.1:p.Leu597Val, XP_016878342.1:p.Leu607, XP_016878342.1:p.Leu607Val, XP_016878343.1:p.Leu606, XP_016878343.1:p.Leu606Val, XP_016878344.1:p.Leu599, XP_016878344.1:p.Leu599Val, XP_016878345.1:p.Leu598, XP_016878345.1:p.Leu598Val, XP_016878346.1:p.Leu597, XP_016878346.1:p.Leu597Val, XP_016878347.1:p.Leu596, XP_016878347.1:p.Leu596Val
    5.

    Display Settings:

    Format
    Items per page
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center