Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 588

1.
2.
3.
4.

rs781362388 [Homo sapiens]
    GCACAGCATCTGCAGATGTTTCCAC[G/T]GACACTCGGAAAGCCGGTGAGTCCT
    Chromosome:
    16:13944819
    Gene:
    ERCC4 (GeneView)
    Functional Consequence:
    synonymous codon
    Validated:
    by frequency
    HGVS:
    NC_000016.10:g.13944819T>G, NC_000016.9:g.14038676T>G, NG_011442.1:g.29663T>G, NM_005236.2:c.2001T>G, NP_005227.1:p.Thr667, XM_011522424.2:c.2139T>G, XM_011522427.1:c.651T>G, XM_017023043.1:c.1212T>G, XP_011520726.1:p.Thr713, XP_011520729.1:p.Thr217, XP_016878532.1:p.Thr404, XR_243267.1:n.2007T>G
    5.

    rs780996067 [Homo sapiens]
      AAATTAAGCATGAAGAATTTGATGT[A/G]AATTTGTCATCGGATGCTGCTTTCG
      Chromosome:
      16:13935540
      Gene:
      ERCC4 (GeneView)
      Functional Consequence:
      synonymous codon
      Validated:
      no info
      HGVS:
      NC_000016.10:g.13935540A>G, NC_000016.9:g.14029397A>G, NG_011442.1:g.20384A>G, NM_005236.2:c.1608A>G, NP_005227.1:p.Val536, XM_011522424.2:c.1746A>G, XM_011522427.1:c.258A>G, XM_017023043.1:c.819A>G, XP_011520726.1:p.Val582, XP_011520729.1:p.Val86, XP_016878532.1:p.Val273, XR_243267.1:n.1614A>G
      6.
      7.
      8.
      9.
      10.
      12.
      14.

      rs780219730 [Homo sapiens]
        TCTCAGTATGATTGTGTCACATTTC[A/T]TAATCTTCTGGAATCTCTGAGAGCA
        Chromosome:
        16:13930837
        Gene:
        ERCC4 (GeneView)
        Functional Consequence:
        missense,upstream variant 2KB
        Validated:
        no info
        HGVS:
        NC_000016.10:g.13930837T>A, NC_000016.9:g.14024694T>A, NG_011442.1:g.15681T>A, NM_005236.2:c.920T>A, NP_005227.1:p.Leu307His, XM_011522424.2:c.1058T>A, XM_011522427.1:c.-1816T>A, XM_017023043.1:c.131T>A, XP_011520726.1:p.Leu353His, XP_016878532.1:p.Leu44His, XR_243267.1:n.926T>A
        15.

        rs780166871 [Homo sapiens]
          TGGACATTTTAAATGCATGTCTAAA[A/G]GAACTAAAATGCCATAACCCATCGC
          Chromosome:
          16:13928157
          Gene:
          ERCC4 (GeneView)
          Functional Consequence:
          synonymous codon,utr variant 5 prime
          Validated:
          by frequency
          HGVS:
          NC_000016.10:g.13928157G>A, NC_000016.9:g.14022014G>A, NG_011442.1:g.13001G>A, NM_005236.2:c.714G>A, NP_005227.1:p.Lys238, XM_011522424.2:c.852G>A, XM_017023043.1:c.-224G>A, XP_011520726.1:p.Lys284, XR_243267.1:n.720G>A
          16.

          rs780096152 [Homo sapiens]
            TTGACTTCTTGACTGATAGAATACC[C/T]TCAGATTTAATTACTGGTAAGAATT
            Chromosome:
            16:13922195
            Gene:
            ERCC4 (GeneView)
            Functional Consequence:
            synonymous codon,utr variant 5 prime
            Validated:
            no info
            HGVS:
            NC_000016.10:g.13922195T>C, NC_000016.9:g.14016052T>C, NG_011121.2:g.607A>G, NG_011442.1:g.7039T>C, NM_005236.2:c.372T>C, NP_005227.1:p.Pro124, XM_011522424.2:c.372T>C, XM_017023043.1:c.-566T>C, XP_011520726.1:p.Pro124, XR_243267.1:n.378T>C
            17.
            18.
            19.

            rs779737289 [Homo sapiens]
              ACCATGCTTGCTATACAGACTGCTA[C/T]ACTGGACATTTTAAATGCATGTCTA
              Chromosome:
              16:13928129
              Gene:
              ERCC4 (GeneView)
              Functional Consequence:
              missense,utr variant 5 prime
              Validated:
              no info
              HGVS:
              NC_000016.10:g.13928129T>C, NC_000016.9:g.14021986T>C, NG_011442.1:g.12973T>C, NM_005236.2:c.686T>C, NP_005227.1:p.Ile229Thr, XM_011522424.2:c.824T>C, XM_017023043.1:c.-252T>C, XP_011520726.1:p.Ile275Thr, XR_243267.1:n.692T>C
              20.

              rs779538282 [Homo sapiens]
                GGCGCGGACCGGCTCCTCTACCACT[A/T]TCTCCAGCTGCACTGCCACCCAGCC
                Chromosome:
                16:13920308
                Gene:
                ERCC4 (GeneView)
                Functional Consequence:
                missense,utr variant 5 prime
                Validated:
                no info
                HGVS:
                NC_000016.10:g.13920308T>A, NC_000016.9:g.14014165T>A, NG_011442.1:g.5152T>A, NM_005236.2:c.143T>A, NP_005227.1:p.Phe48Tyr, XM_011522424.2:c.143T>A, XM_017023043.1:c.-795T>A, XP_011520726.1:p.Phe48Tyr, XR_243267.1:n.149T>A

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center