Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 1014

1.

rs781780309 [Homo sapiens]
    TTCTATTCCATCCGGAAGCAGTACA[A/C/T]ATCTGAGGAGTCGACCCTCTCAGGC
    Chromosome:
    3:37048986
    Gene:
    MLH1 (GeneView)
    Functional Consequence:
    intron variant,missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Uncertain significance
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000003.11:g.37090477T>A, NC_000003.11:g.37090477T>C, NC_000003.12:g.37048986T>A, NC_000003.12:g.37048986T>C, NG_007109.2:g.60637T>A, NG_007109.2:g.60637T>C, NM_000249.3:c.2072T>A, NM_000249.3:c.2072T>C, NM_001167617.1:c.1778T>A, NM_001167617.1:c.1778T>C, NM_001167618.1:c.1349T>A, NM_001167618.1:c.1349T>C, NM_001167619.1:c.1349T>A, NM_001167619.1:c.1349T>C, NM_001258271.1:c.1896+1303T>A, NM_001258271.1:c.1896+1303T>C, NM_001258273.1:c.1349T>A, NM_001258273.1:c.1349T>C, NM_001258274.1:c.1349T>A, NM_001258274.1:c.1349T>C, NP_000240.1:p.Ile691Lys, NP_000240.1:p.Ile691Thr, NP_001161089.1:p.Ile593Lys, NP_001161089.1:p.Ile593Thr, NP_001161090.1:p.Ile450Lys, NP_001161090.1:p.Ile450Thr, NP_001161091.1:p.Ile450Lys, NP_001161091.1:p.Ile450Thr, NP_001245202.1:p.Ile450Lys, NP_001245202.1:p.Ile450Thr, NP_001245203.1:p.Ile450Lys, NP_001245203.1:p.Ile450Thr, XM_005265161.1:c.1865T>A, XM_005265161.1:c.1865T>C, XM_005265162.1:c.1778T>A, XM_005265162.1:c.1778T>C, XM_005265163.1:c.1349T>A, XM_005265163.1:c.1349T>C, XM_005265164.1:c.1349T>A, XM_005265164.1:c.1349T>C, XM_005265165.1:c.1349T>A, XM_005265165.1:c.1349T>C, XM_005265166.1:c.1049T>A, XM_005265166.1:c.1049T>C, XM_011533727.1:c.998T>A, XM_011533727.1:c.998T>C, XM_017006449.1:c.1049T>A, XM_017006449.1:c.1049T>C, XM_017006450.1:c.1049T>A, XM_017006450.1:c.1049T>C, XM_017006451.1:c.998T>A, XM_017006451.1:c.998T>C, XP_005265218.1:p.Ile622Lys, XP_005265218.1:p.Ile622Thr, XP_005265219.1:p.Ile593Lys, XP_005265219.1:p.Ile593Thr, XP_005265220.1:p.Ile450Lys, XP_005265220.1:p.Ile450Thr, XP_005265221.1:p.Ile450Lys, XP_005265221.1:p.Ile450Thr, XP_005265222.1:p.Ile450Lys, XP_005265222.1:p.Ile450Thr, XP_005265223.1:p.Ile350Lys, XP_005265223.1:p.Ile350Thr, XP_011532029.1:p.Ile333Lys, XP_011532029.1:p.Ile333Thr, XP_016861938.1:p.Ile350Lys, XP_016861938.1:p.Ile350Thr, XP_016861939.1:p.Ile350Lys, XP_016861939.1:p.Ile350Thr, XP_016861940.1:p.Ile333Lys, XP_016861940.1:p.Ile333Thr
    4.

    rs781637991 [Homo sapiens]
      GACGAAGAAAAGGAATGTTTTGAAA[A/C/G/T]CCTCAGTAAAGAATGCGCTATGTTC
      Chromosome:
      3:37048938
      Gene:
      MLH1 (GeneView)
      Functional Consequence:
      intron variant,missense
      Allele Origin:
      G(germline)/T(germline)
      Clinical significance:
      Uncertain significance
      Validated:
      by cluster,by frequency
      HGVS:
      NC_000003.11:g.37090429G>A, NC_000003.11:g.37090429G>C, NC_000003.11:g.37090429G>T, NC_000003.12:g.37048938G>A, NC_000003.12:g.37048938G>C, NC_000003.12:g.37048938G>T, NG_007109.2:g.60589G>A, NG_007109.2:g.60589G>C, NG_007109.2:g.60589G>T, NM_000249.3:c.2024G>A, NM_000249.3:c.2024G>C, NM_000249.3:c.2024G>T, NM_001167617.1:c.1730G>A, NM_001167617.1:c.1730G>C, NM_001167617.1:c.1730G>T, NM_001167618.1:c.1301G>A, NM_001167618.1:c.1301G>C, NM_001167618.1:c.1301G>T, NM_001167619.1:c.1301G>A, NM_001167619.1:c.1301G>C, NM_001167619.1:c.1301G>T, NM_001258271.1:c.1896+1255G>A, NM_001258271.1:c.1896+1255G>C, NM_001258271.1:c.1896+1255G>T, NM_001258273.1:c.1301G>A, NM_001258273.1:c.1301G>C, NM_001258273.1:c.1301G>T, NM_001258274.1:c.1301G>A, NM_001258274.1:c.1301G>C, NM_001258274.1:c.1301G>T, NP_000240.1:p.Ser675Asn, NP_000240.1:p.Ser675Ile, NP_000240.1:p.Ser675Thr, NP_001161089.1:p.Ser577Asn, NP_001161089.1:p.Ser577Ile, NP_001161089.1:p.Ser577Thr, NP_001161090.1:p.Ser434Asn, NP_001161090.1:p.Ser434Ile, NP_001161090.1:p.Ser434Thr, NP_001161091.1:p.Ser434Asn, NP_001161091.1:p.Ser434Ile, NP_001161091.1:p.Ser434Thr, NP_001245202.1:p.Ser434Asn, NP_001245202.1:p.Ser434Ile, NP_001245202.1:p.Ser434Thr, NP_001245203.1:p.Ser434Asn, NP_001245203.1:p.Ser434Ile, NP_001245203.1:p.Ser434Thr, XM_005265161.1:c.1817G>A, XM_005265161.1:c.1817G>C, XM_005265161.1:c.1817G>T, XM_005265162.1:c.1730G>A, XM_005265162.1:c.1730G>C, XM_005265162.1:c.1730G>T, XM_005265163.1:c.1301G>A, XM_005265163.1:c.1301G>C, XM_005265163.1:c.1301G>T, XM_005265164.1:c.1301G>A, XM_005265164.1:c.1301G>C, XM_005265164.1:c.1301G>T, XM_005265165.1:c.1301G>A, XM_005265165.1:c.1301G>C, XM_005265165.1:c.1301G>T, XM_005265166.1:c.1001G>A, XM_005265166.1:c.1001G>C, XM_005265166.1:c.1001G>T, XM_011533727.1:c.950G>A, XM_011533727.1:c.950G>C, XM_011533727.1:c.950G>T, XM_017006449.1:c.1001G>A, XM_017006449.1:c.1001G>C, XM_017006449.1:c.1001G>T, XM_017006450.1:c.1001G>A, XM_017006450.1:c.1001G>C, XM_017006450.1:c.1001G>T, XM_017006451.1:c.950G>A, XM_017006451.1:c.950G>C, XM_017006451.1:c.950G>T, XP_005265218.1:p.Ser606Asn, XP_005265218.1:p.Ser606Ile, XP_005265218.1:p.Ser606Thr, XP_005265219.1:p.Ser577Asn, XP_005265219.1:p.Ser577Ile, XP_005265219.1:p.Ser577Thr, XP_005265220.1:p.Ser434Asn, XP_005265220.1:p.Ser434Ile, XP_005265220.1:p.Ser434Thr, XP_005265221.1:p.Ser434Asn, XP_005265221.1:p.Ser434Ile, XP_005265221.1:p.Ser434Thr, XP_005265222.1:p.Ser434Asn, XP_005265222.1:p.Ser434Ile, XP_005265222.1:p.Ser434Thr, XP_005265223.1:p.Ser334Asn, XP_005265223.1:p.Ser334Ile, XP_005265223.1:p.Ser334Thr, XP_011532029.1:p.Ser317Asn, XP_011532029.1:p.Ser317Ile, XP_011532029.1:p.Ser317Thr, XP_016861938.1:p.Ser334Asn, XP_016861938.1:p.Ser334Ile, XP_016861938.1:p.Ser334Thr, XP_016861939.1:p.Ser334Asn, XP_016861939.1:p.Ser334Ile, XP_016861939.1:p.Ser334Thr, XP_016861940.1:p.Ser317Asn, XP_016861940.1:p.Ser317Ile, XP_016861940.1:p.Ser317Thr
      15.

      rs780221881 [Homo sapiens]
        CTTCATTTTTATTTTCAGTGAAGAA[A/C/T]TGTTCTACCAGATACTCATTTATGA
        Chromosome:
        3:37042275
        Gene:
        MLH1 (GeneView)
        Functional Consequence:
        missense,synonymous codon
        Clinical significance:
        Uncertain significance
        Validated:
        no info
        HGVS:
        NC_000003.11:g.37083766C>T, NC_000003.12:g.37042275C>A, NC_000003.12:g.37042275C>T, NG_007109.2:g.53926C>A, NG_007109.2:g.53926C>T, NM_000249.3:c.1675C>A, NM_000249.3:c.1675C>T, NM_001167617.1:c.1381C>A, NM_001167617.1:c.1381C>T, NM_001167618.1:c.952C>A, NM_001167618.1:c.952C>T, NM_001167619.1:c.952C>A, NM_001167619.1:c.952C>T, NM_001258271.1:c.1675C>A, NM_001258271.1:c.1675C>T, NM_001258273.1:c.952C>A, NM_001258273.1:c.952C>T, NM_001258274.1:c.952C>A, NM_001258274.1:c.952C>T, NP_000240.1:p.Leu559, NP_000240.1:p.Leu559Met, NP_001161089.1:p.Leu461, NP_001161089.1:p.Leu461Met, NP_001161090.1:p.Leu318, NP_001161090.1:p.Leu318Met, NP_001161091.1:p.Leu318, NP_001161091.1:p.Leu318Met, NP_001245200.1:p.Leu559, NP_001245200.1:p.Leu559Met, NP_001245202.1:p.Leu318, NP_001245202.1:p.Leu318Met, NP_001245203.1:p.Leu318, NP_001245203.1:p.Leu318Met, XM_005265161.1:c.1468C>A, XM_005265161.1:c.1468C>T, XM_005265162.1:c.1381C>T, XM_005265163.1:c.952C>A, XM_005265163.1:c.952C>T, XM_005265164.1:c.952C>A, XM_005265164.1:c.952C>T, XM_005265165.1:c.952C>T, XM_005265166.1:c.652C>A, XM_005265166.1:c.652C>T, XM_011533727.1:c.601C>A, XM_011533727.1:c.601C>T, XM_017006449.1:c.652C>A, XM_017006449.1:c.652C>T, XM_017006450.1:c.652C>A, XM_017006450.1:c.652C>T, XM_017006451.1:c.601C>A, XM_017006451.1:c.601C>T, XP_005265218.1:p.Leu490, XP_005265218.1:p.Leu490Met, XP_005265219.1:p.Leu461, XP_005265220.1:p.Leu318, XP_005265220.1:p.Leu318Met, XP_005265221.1:p.Leu318, XP_005265221.1:p.Leu318Met, XP_005265222.1:p.Leu318, XP_005265223.1:p.Leu218, XP_005265223.1:p.Leu218Met, XP_011532029.1:p.Leu201, XP_011532029.1:p.Leu201Met, XP_016861938.1:p.Leu218, XP_016861938.1:p.Leu218Met, XP_016861939.1:p.Leu218, XP_016861939.1:p.Leu218Met, XP_016861940.1:p.Leu201, XP_016861940.1:p.Leu201Met

        Display Settings:

        Format
        Items per page
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center