Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 201

1.

rs781568641 [Homo sapiens]
    CAAGATCCTTCAGCTTCTAAAACAC[A/G]AGAATGTGGTCAACTTGATTGAGAT
    Chromosome:
    9:127787569
    Gene:
    CDK9 (GeneView)
    Functional Consequence:
    missense,utr variant 5 prime
    Validated:
    no info
    HGVS:
    NC_000009.11:g.130549848G>A, NC_000009.12:g.127787569G>A, NG_029812.1:g.6652G>A, NG_033942.1:g.6544G>A, NM_001261.3:c.226G>A, NP_001252.1:p.Glu76Lys, XM_017014184.1:c.-356G>A
    2.

    rs781408491 [Homo sapiens]
      GCTACACCAACCGTGTGGTGACACT[C/G]TGGTACCGGCCCCCGGAGCTGTTGC
      Chromosome:
      9:127788357
      Gene:
      CDK9 (GeneView)
      Functional Consequence:
      synonymous codon
      Validated:
      no info
      HGVS:
      NC_000009.11:g.130550636C>G, NC_000009.12:g.127788357C>G, NG_033942.1:g.7332C>G, NM_001261.3:c.576C>G, NP_001252.1:p.Leu192, XM_017014184.1:c.189C>G, XP_016869673.1:p.Leu63
      3.

      rs781197980 [Homo sapiens]
        GAGTGCCCTTTTTGTGATGAAGTTT[C/T]CAAATACGAGAAGCTCGCCAAGATC
        Chromosome:
        9:127786198
        Gene:
        CDK9 (GeneView) MIR2861 (GeneView) MIR3960 (GeneView)
        Functional Consequence:
        downstream variant 500B,missense,utr variant 5 prime
        Validated:
        no info
        HGVS:
        NC_000009.11:g.130548477C>T, NC_000009.12:g.127786198C>T, NG_029812.1:g.5281C>T, NG_033942.1:g.5173C>T, NM_001261.3:c.50C>T, NP_001252.1:p.Ser17Phe, NR_036055.1:n.281C>T, NR_039767.1:n.366C>T, XM_017014184.1:c.-532C>T
        4.

        rs781196606 [Homo sapiens]
          GAAGGCCTATGTGCGTGACCCATAC[A/G]CACTGGACCTCATCGACAAGCTGCT
          Chromosome:
          9:127789286
          Gene:
          CDK9 (GeneView)
          Functional Consequence:
          missense
          Validated:
          by frequency
          HGVS:
          NC_000009.11:g.130551565G>A, NC_000009.12:g.127789286G>A, NG_033942.1:g.8261G>A, NM_001261.3:c.862G>A, NP_001252.1:p.Ala288Thr, XM_017014184.1:c.475G>A, XP_016869673.1:p.Ala159Thr
          5.

          rs780602892 [Homo sapiens]
            TTTCCGCCTGCAGGGAGGTGTTCAA[A/G]GCCAGGCACCGCAAGACCGGCCAGA
            Chromosome:
            9:127786713
            Gene:
            CDK9 (GeneView)
            Functional Consequence:
            synonymous codon,utr variant 5 prime
            Validated:
            by cluster,by frequency
            HGVS:
            NC_000009.11:g.130548992G>A, NC_000009.12:g.127786713G>A, NG_029812.1:g.5796G>A, NG_033942.1:g.5688G>A, NM_001261.3:c.105G>A, NP_001252.1:p.Lys35, XM_017014184.1:c.-477G>A
            6.

            rs780150586 [Homo sapiens]
              CACCCAGCAGTCCACCAACCAGAGT[C/T]GCAATCCCGCCACCACCAACCAGAC
              Chromosome:
              9:127789496
              Gene:
              CDK9 (GeneView)
              Functional Consequence:
              missense
              Validated:
              by frequency
              HGVS:
              NC_000009.11:g.130551775C>T, NC_000009.12:g.127789496C>T, NG_033942.1:g.8471C>T, NM_001261.3:c.1072C>T, NP_001252.1:p.Arg358Cys, XM_017014184.1:c.685C>T, XP_016869673.1:p.Arg229Cys
              7.

              rs780150458 [Homo sapiens]
                GTATATACCTGGTGTTCGACTTCTG[C/T]GAGCATGACCTTGCTGGGCTGTTGA
                Chromosome:
                9:127787999
                Gene:
                CDK9 (GeneView)
                Functional Consequence:
                synonymous codon,utr variant 5 prime
                Validated:
                no info
                HGVS:
                NC_000009.11:g.130550278C>T, NC_000009.12:g.127787999C>T, NG_029812.1:g.7082C>T, NG_033942.1:g.6974C>T, NM_001261.3:c.318C>T, NP_001252.1:p.Cys106, XM_017014184.1:c.-70C>T
                8.

                rs780095447 [Homo sapiens]
                  ACTTCTTCTGGTCCGACCCCATGCC[C/T]TCCGACCTCAAGGGCATGCTCTCCA
                  Chromosome:
                  9:127789387
                  Gene:
                  CDK9 (GeneView)
                  Functional Consequence:
                  synonymous codon
                  Validated:
                  by frequency
                  HGVS:
                  NC_000009.11:g.130551666C>T, NC_000009.12:g.127789387C>T, NG_033942.1:g.8362C>T, NM_001261.3:c.963C>T, NP_001252.1:p.Pro321, XM_017014184.1:c.576C>T, XP_016869673.1:p.Pro192
                  9.

                  rs779479066 [Homo sapiens]
                    GCCCCATCATGCAGGGCAACACGGA[A/G]CAGCACCAACTCGCCCTCATCAGTC
                    Chromosome:
                    9:127788641
                    Gene:
                    CDK9 (GeneView)
                    Functional Consequence:
                    synonymous codon
                    Validated:
                    by frequency
                    HGVS:
                    NC_000009.11:g.130550920G>A, NC_000009.12:g.127788641G>A, NG_033942.1:g.7616G>A, NM_001261.3:c.702G>A, NP_001252.1:p.Glu234, XM_017014184.1:c.315G>A, XP_016869673.1:p.Glu105
                    10.

                    rs779167622 [Homo sapiens]
                      TCCGCCTGCAGGGAGGTGTTCAAGG[C/G]CAGGCACCGCAAGACCGGCCAGAAG
                      Chromosome:
                      9:127786715
                      Gene:
                      CDK9 (GeneView)
                      Functional Consequence:
                      missense,utr variant 5 prime
                      Validated:
                      no info
                      HGVS:
                      NC_000009.11:g.130548994C>G, NC_000009.12:g.127786715C>G, NG_029812.1:g.5798C>G, NG_033942.1:g.5690C>G, NM_001261.3:c.107C>G, NP_001252.1:p.Ala36Gly, XM_017014184.1:c.-475C>G
                      11.

                      rs778916606 [Homo sapiens]
                        GCAGTCCACCAACCAGAGTCGCAAT[C/G]CCGCCACCACCAACCAGACGGAGTT
                        Chromosome:
                        9:127789502
                        Gene:
                        CDK9 (GeneView)
                        Functional Consequence:
                        missense
                        Validated:
                        by frequency
                        HGVS:
                        NC_000009.11:g.130551781C>G, NC_000009.12:g.127789502C>G, NG_033942.1:g.8477C>G, NM_001261.3:c.1078C>G, NP_001252.1:p.Pro360Ala, XM_017014184.1:c.691C>G, XP_016869673.1:p.Pro231Ala
                        12.

                        rs778663248 [Homo sapiens]
                          TCTTCCCAGGGGAGCGGGACTACGG[-/C]CCCCCCATTGACCTGTGGGGTGCTG
                          Chromosome:
                          9:127788560
                          Gene:
                          CDK9 (GeneView)
                          Functional Consequence:
                          frameshift variant
                          Validated:
                          by frequency
                          HGVS:
                          NC_000009.11:g.130550839delC, NC_000009.12:g.127788560delC, NG_033942.1:g.7535delC, NM_001261.3:c.621delC, NP_001252.1:p.Ile210Leufs, XM_017014184.1:c.234delC, XP_016869673.1:p.Ile81Leufs
                          13.

                          rs778462348 [Homo sapiens]
                            AGCTGGTCAAGGGCCAGAAGCGGAA[A/G]GTGAAGGACAGGCTGAAGGCCTATG
                            Chromosome:
                            9:127789246
                            Gene:
                            CDK9 (GeneView)
                            Functional Consequence:
                            synonymous codon
                            Validated:
                            no info
                            HGVS:
                            NC_000009.11:g.130551525G>A, NC_000009.12:g.127789246G>A, NG_033942.1:g.8221G>A, NM_001261.3:c.822G>A, NP_001252.1:p.Lys274, XM_017014184.1:c.435G>A, XP_016869673.1:p.Lys145
                            14.

                            rs778441690 [Homo sapiens]
                              TGTTCAAGGCCAGGCACCGCAAGAC[C/G]GGCCAGAAGGTGGCTCTGAAGAAGG
                              Chromosome:
                              9:127786731
                              Gene:
                              CDK9 (GeneView)
                              Functional Consequence:
                              synonymous codon,utr variant 5 prime
                              Validated:
                              no info
                              HGVS:
                              NC_000009.11:g.130549010C>G, NC_000009.12:g.127786731C>G, NG_029812.1:g.5814C>G, NG_033942.1:g.5706C>G, NM_001261.3:c.123C>G, NP_001252.1:p.Thr41, XM_017014184.1:c.-459C>G
                              15.

                              rs778384628 [Homo sapiens]
                                AGGGCAACACGGAGCAGCACCAACT[C/T]GCCCTCATCAGTCAGCTCTGCGGCT
                                Chromosome:
                                9:127788653
                                Gene:
                                CDK9 (GeneView)
                                Functional Consequence:
                                synonymous codon
                                Validated:
                                by frequency
                                HGVS:
                                NC_000009.11:g.130550932C>T, NC_000009.12:g.127788653C>T, NG_033942.1:g.7628C>T, NM_001261.3:c.714C>T, NP_001252.1:p.Leu238, XM_017014184.1:c.327C>T, XP_016869673.1:p.Leu109
                                16.

                                rs777924310 [Homo sapiens]
                                  GTCCACCAACCAGAGTCGCAATCCC[A/G]CCACCACCAACCAGACGGAGTTTGA
                                  Chromosome:
                                  9:127789505
                                  Gene:
                                  CDK9 (GeneView)
                                  Functional Consequence:
                                  missense
                                  Validated:
                                  by frequency
                                  HGVS:
                                  NC_000009.11:g.130551784G>A, NC_000009.12:g.127789505G>A, NG_033942.1:g.8480G>A, NM_001261.3:c.1081G>A, NP_001252.1:p.Ala361Thr, XM_017014184.1:c.694G>A, XP_016869673.1:p.Ala232Thr
                                  17.

                                  rs777792275 [Homo sapiens]
                                    TGGAGGCGGCCATGGCAAAGCAGTA[A/C]GACTCGGTGGAGTGCCCTTTTTGTG
                                    Chromosome:
                                    9:127786163
                                    Gene:
                                    CDK9 (GeneView) MIR2861 (GeneView) MIR3960 (GeneView)
                                    Functional Consequence:
                                    downstream variant 500B,stop gained,utr variant 5 prime
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000009.11:g.130548442C>A, NC_000009.12:g.127786163C>A, NG_029812.1:g.5246C>A, NG_033942.1:g.5138C>A, NM_001261.3:c.15C>A, NP_001252.1:p.Tyr5Ter, NR_036055.1:n.246C>A, NR_039767.1:n.331C>A, XM_017014184.1:c.-567C>A
                                    18.

                                    rs777735060 [Homo sapiens]
                                      GCCAAGAACAGCCAGCCCAACCGCT[A/G]CACCAACCGTGTGGTGACACTCTGG
                                      Chromosome:
                                      9:127788335
                                      Gene:
                                      CDK9 (GeneView)
                                      Functional Consequence:
                                      missense
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000009.11:g.130550614A>G, NC_000009.12:g.127788335A>G, NG_033942.1:g.7310A>G, NM_001261.3:c.554A>G, NP_001252.1:p.Tyr185Cys, XM_017014184.1:c.167A>G, XP_016869673.1:p.Tyr56Cys
                                      19.

                                      rs777252301 [Homo sapiens]
                                        TGAAGGACAGGCTGAAGGCCTATGT[G/T]CGTGACCCATACGCACTGGACCTCA
                                        Chromosome:
                                        9:127789273
                                        Gene:
                                        CDK9 (GeneView)
                                        Functional Consequence:
                                        synonymous codon
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000009.11:g.130551552G>T, NC_000009.12:g.127789273G>T, NG_033942.1:g.8248G>T, NM_001261.3:c.849G>T, NP_001252.1:p.Val283, XM_017014184.1:c.462G>T, XP_016869673.1:p.Val154
                                        20.

                                        rs777066206 [Homo sapiens]
                                          ACCTGACGTCCATGTTCGAGTACTT[A/G]GCACCACCGCGCCGGAAGGGCAGCC
                                          Chromosome:
                                          9:127789441
                                          Gene:
                                          CDK9 (GeneView)
                                          Functional Consequence:
                                          synonymous codon
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000009.11:g.130551720G>A, NC_000009.12:g.127789441G>A, NG_033942.1:g.8416G>A, NM_001261.3:c.1017G>A, NP_001252.1:p.Leu339, XM_017014184.1:c.630G>A, XP_016869673.1:p.Leu210

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center