Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 199

2.

rs781682499 [Homo sapiens]
    GCGGTGAGCCCCTATCCTACCTTCA[A/G]TCCATCCTCGGATGTCGCTGCCTTG
    Chromosome:
    9:73158756
    Gene:
    ANXA1 (GeneView)
    Functional Consequence:
    missense
    Validated:
    no info
    HGVS:
    CM000671.2:g.73158756A>G, NC_000009.11:g.75773672A>G, NC_000009.12:g.73158756A>G, NM_000700.2:c.128A>G, NP_000691.1:p.Asn43Ser, XP_005252007.1:p.Asn54Ser, XP_011516911.1:p.Asn43Ser, XP_016870146.1:p.Asn54Ser
    4.

    rs781618965 [Homo sapiens]
      ACAAGCAAACCAGCTTTCTTTGCAG[A/G]GAAGCTTCATCAAGCCATGAAAGTA
      Chromosome:
      9:73167533
      Gene:
      ANXA1 (GeneView)
      Functional Consequence:
      missense
      Validated:
      no info
      HGVS:
      CM000671.2:g.73167533A>G, NC_000009.11:g.75782449A>G, NC_000009.12:g.73167533A>G, NM_000700.2:c.839A>G, NP_000691.1:p.Glu280Gly, XP_005252007.1:p.Glu291Gly, XP_011516911.1:p.Glu280Gly, XP_016870146.1:p.Glu291Gly
      5.

      rs781229810 [Homo sapiens]
        GGGCCTTGGAACTGATGAAGATACT[C/G]TAATTGAGATTTTGGCATCAAGAAC
        Chromosome:
        9:73160827
        Gene:
        ANXA1 (GeneView)
        Functional Consequence:
        missense
        Validated:
        by frequency
        HGVS:
        CM000671.2:g.73160827C>G, NC_000009.11:g.75775743C>G, NC_000009.12:g.73160827C>G, NM_000700.2:c.409C>G, NP_000691.1:p.Leu137Val, XP_005252007.1:p.Leu148Val, XP_011516911.1:p.Leu137Val, XP_016870146.1:p.Leu148Val
        6.

        rs780992950 [Homo sapiens]
          TAAGCGAAACAATGCACAGCGTCAA[C/T]AGATCAAAGCAGCATATCTCCAGGA
          Chromosome:
          9:73159388
          Gene:
          ANXA1 (GeneView)
          Functional Consequence:
          stop gained
          Validated:
          no info
          HGVS:
          CM000671.2:g.73159388C>T, NC_000009.11:g.75774304C>T, NC_000009.12:g.73159388C>T, NM_000700.2:c.235C>T, NP_000691.1:p.Gln79Ter, XP_005252007.1:p.Gln90Ter, XP_011516911.1:p.Gln79Ter, XP_016870146.1:p.Gln90Ter
          7.

          rs780540903 [Homo sapiens]
            GTTTATTGAAAATGAAGAGCAGGAA[C/T]ATGTTGTAAGTAGAGTGATAATAAA
            Chromosome:
            9:73158596
            Gene:
            ANXA1 (GeneView)
            Functional Consequence:
            missense
            Validated:
            by frequency
            HGVS:
            CM000671.2:g.73158596T>C, NC_000009.11:g.75773512T>C, NC_000009.12:g.73158596T>C, NM_000700.2:c.61T>C, NP_000691.1:p.Tyr21His, XP_005252007.1:p.Tyr32His, XP_011516911.1:p.Tyr21His, XP_016870146.1:p.Tyr32His
            8.

            rs780151305 [Homo sapiens]
              AGCCCTTACAGGTCACCTTGAGGAG[A/G]TTGTTTTAGCTCTGCTAAAAACTCC
              Chromosome:
              9:73160311
              Gene:
              ANXA1 (GeneView)
              Functional Consequence:
              missense
              Validated:
              by frequency
              HGVS:
              CM000671.2:g.73160311G>A, NC_000009.11:g.75775227G>A, NC_000009.12:g.73160311G>A, NM_000700.2:c.319G>A, NP_000691.1:p.Val107Ile, XP_005252007.1:p.Val118Ile, XP_011516911.1:p.Val107Ile, XP_016870146.1:p.Val118Ile
              9.

              rs780032916 [Homo sapiens]
                CTACCTTCAATCCATCCTCGGATGT[C/T]GCTGCCTTGCATAAGGCCATAATGG
                Chromosome:
                9:73158772
                Gene:
                ANXA1 (GeneView)
                Functional Consequence:
                synonymous codon
                Validated:
                by frequency
                HGVS:
                CM000671.2:g.73158772C>T, NC_000009.11:g.75773688C>T, NC_000009.12:g.73158772C>T, NM_000700.2:c.144C>T, NP_000691.1:p.Val48, XP_005252007.1:p.Val59, XP_011516911.1:p.Val48, XP_016870146.1:p.Val59
                10.

                rs779921203 [Homo sapiens]
                  AAGCATTCTATCAGAAGATGTATGG[C/T]ATCTCCCTTTGCCAAGCCATCCTGG
                  Chromosome:
                  9:73169130
                  Gene:
                  ANXA1 (GeneView)
                  Functional Consequence:
                  synonymous codon
                  Validated:
                  by frequency
                  HGVS:
                  CM000671.2:g.73169130T>C, NC_000009.11:g.75784046T>C, NC_000009.12:g.73169130T>C, NM_000700.2:c.960T>C, NP_000691.1:p.Gly320, XP_005252007.1:p.Gly331, XP_011516911.1:p.Gly320, XP_016870146.1:p.Gly331
                  11.

                  rs779798345 [Homo sapiens]
                    GGGTGTTGGAACTCGCCATAAGGCA[A/T]TGATCAGGATTATGGTTTCCCGTTC
                    Chromosome:
                    9:73169056
                    Gene:
                    ANXA1 (GeneView)
                    Functional Consequence:
                    missense
                    Validated:
                    by frequency
                    HGVS:
                    CM000671.2:g.73169056T>A, NC_000009.11:g.75783972T>A, NC_000009.12:g.73169056T>A, NM_000700.2:c.886T>A, NP_000691.1:p.Leu296Met, XP_005252007.1:p.Leu307Met, XP_011516911.1:p.Leu296Met, XP_016870146.1:p.Leu307Met
                    12.

                    rs779426054 [Homo sapiens]
                      AACCTCAGACACATCTGGAGATTTT[C/T]GGAACGCTTTGCTTTCTCTTGCTAA
                      Chromosome:
                      9:73162835
                      Gene:
                      ANXA1 (GeneView)
                      Functional Consequence:
                      missense
                      Validated:
                      no info
                      HGVS:
                      CM000671.2:g.73162835C>T, NC_000009.11:g.75777751C>T, NC_000009.12:g.73162835C>T, NM_000700.2:c.529C>T, NP_000691.1:p.Arg177Trp, XP_005252007.1:p.Arg188Trp, XP_011516911.1:p.Arg177Trp, XP_016870146.1:p.Arg188Trp
                      13.

                      rs779281935 [Homo sapiens]
                        GATGAAACACTGAAGAAAGCCCTTA[A/C]AGGTCACCTTGAGGAGGTTGTTTTA
                        Chromosome:
                        9:73160294
                        Gene:
                        ANXA1 (GeneView)
                        Functional Consequence:
                        missense
                        Validated:
                        by frequency
                        HGVS:
                        CM000671.2:g.73160294C>A, NC_000009.11:g.75775210C>A, NC_000009.12:g.73160294C>A, NM_000700.2:c.302C>A, NP_000691.1:p.Thr101Lys, XP_005252007.1:p.Thr112Lys, XP_011516911.1:p.Thr101Lys, XP_016870146.1:p.Thr112Lys
                        14.

                        rs779021366 [Homo sapiens]
                          ATCTTAGTTTGAATTTAATATTCAG[C/T]GTTTCAGAAATACACCAAGTACAGT
                          Chromosome:
                          9:73166097
                          Gene:
                          ANXA1 (GeneView)
                          Functional Consequence:
                          missense
                          Validated:
                          no info
                          HGVS:
                          CM000671.2:g.73166097T>C, NC_000009.11:g.75781013T>C, NC_000009.12:g.73166097T>C, NM_000700.2:c.707T>C, NP_000691.1:p.Val236Ala, XP_005252007.1:p.Val247Ala, XP_011516911.1:p.Val236Ala, XP_016870146.1:p.Val247Ala
                          15.

                          rs778889698 [Homo sapiens]
                            GGGTGACCGATCTGAGGACTTTGGT[A/G]TGAATGAAGACTTGGCTGATTCAGA
                            Chromosome:
                            9:73163500
                            Gene:
                            ANXA1 (GeneView)
                            Functional Consequence:
                            missense
                            Validated:
                            by frequency
                            HGVS:
                            CM000671.2:g.73163500G>A, NC_000009.11:g.75778416G>A, NC_000009.12:g.73163500G>A, NM_000700.2:c.580G>A, NP_000691.1:p.Val194Met, XP_005252007.1:p.Val205Met, XP_011516911.1:p.Val194Met, XP_016870146.1:p.Val205Met
                            16.

                            rs778298033 [Homo sapiens]
                              ATATCAAAGCATTCTATCAGAAGAT[A/G]TATGGTATCTCCCTTTGCCAAGCCA
                              Chromosome:
                              9:73169124
                              Gene:
                              ANXA1 (GeneView)
                              Functional Consequence:
                              missense
                              Validated:
                              no info
                              HGVS:
                              CM000671.2:g.73169124G>A, NC_000009.11:g.75784040G>A, NC_000009.12:g.73169124G>A, NM_000700.2:c.954G>A, NP_000691.1:p.Met318Ile, XP_005252007.1:p.Met329Ile, XP_011516911.1:p.Met318Ile, XP_016870146.1:p.Met329Ile
                              18.

                              rs777604252 [Homo sapiens]
                                AAACAATGCACAGCGTCAACAGATC[A/G]AAGCAGCATATCTCCAGGAAACAGG
                                Chromosome:
                                9:73159394
                                Gene:
                                ANXA1 (GeneView)
                                Functional Consequence:
                                missense
                                Validated:
                                no info
                                HGVS:
                                CM000671.2:g.73159394A>G, NC_000009.11:g.75774310A>G, NC_000009.12:g.73159394A>G, NM_000700.2:c.241A>G, NP_000691.1:p.Lys81Glu, XP_005252007.1:p.Lys92Glu, XP_011516911.1:p.Lys81Glu, XP_016870146.1:p.Lys92Glu
                                19.

                                rs777534277 [Homo sapiens]
                                  ATTCTAATCTTTTTTTTTGTAGCCC[A/C]TGGATGAAACACTGAAGAAAGCCCT
                                  Chromosome:
                                  9:73160266
                                  Gene:
                                  ANXA1 (GeneView)
                                  Functional Consequence:
                                  missense
                                  Validated:
                                  no info
                                  HGVS:
                                  CM000671.2:g.73160266C>A, NC_000009.11:g.75775182C>A, NC_000009.12:g.73160266C>A, NM_000700.2:c.274C>A, NP_000691.1:p.Leu92Met, XP_005252007.1:p.Leu103Met, XP_011516911.1:p.Leu92Met, XP_016870146.1:p.Leu103Met

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center