Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 849

1.

rs781782494 [Homo sapiens]
    AGCAAAGATCCAAGACGCCGGCCCT[A/C]TGGGGTCCTAGGGAATTGCAGCTCC
    Chromosome:
    1:156673170
    Gene:
    NES (GeneView)
    Functional Consequence:
    stop gained
    Validated:
    no info
    HGVS:
    NC_000001.10:g.156642962C>A, NC_000001.11:g.156673170C>A, NG_012300.1:g.9228G>T, NM_006617.1:c.1018G>T, NP_006608.1:p.Glu340Ter
    2.

    rs781744047 [Homo sapiens]
      CTGGTGGTACATCCTCCTCAGCTTC[-/CT]CTGACCCCAGAGGCCAAGGTGAAGG
      Chromosome:
      1:156670564
      Gene:
      NES (GeneView)
      Functional Consequence:
      frameshift variant
      Validated:
      by cluster
      HGVS:
      NC_000001.10:g.156640356_156640357delCT, NC_000001.11:g.156670564_156670565delCT, NG_012300.1:g.11833_11834delAG, NM_006617.1:c.3623_3624delAG, NP_006608.1:p.Glu1208Glyfs
      3.

      rs781742750 [Homo sapiens]
        CTCTTACCCTGAAAGCTGAGGGAAG[C/T]CTTGGAGCCACCGCCAGGTGTTTGC
        Chromosome:
        1:156673472
        Gene:
        NES (GeneView)
        Functional Consequence:
        missense
        Validated:
        no info
        HGVS:
        NC_000001.10:g.156643264T>C, NC_000001.11:g.156673472T>C, NG_012300.1:g.8926A>G, NM_006617.1:c.964A>G, NP_006608.1:p.Thr322Ala
        4.

        rs781700176 [Homo sapiens]
          TCCCCTTGAGGGGGTGGCCTCTGCT[C/T]TCCAGTGGGGTCCCACCTGGGGGAG
          Chromosome:
          1:156670236
          Gene:
          NES (GeneView)
          Functional Consequence:
          missense
          Validated:
          by frequency
          HGVS:
          NC_000001.10:g.156640028C>T, NC_000001.11:g.156670236C>T, NG_012300.1:g.12162G>A, NM_006617.1:c.3952G>A, NP_006608.1:p.Glu1318Lys
          5.

          rs781674865 [Homo sapiens]
            GACCCGGGCCAGGTAGGCCTCCAGG[C/T]GCCGATTGAGCTCCCACATCTGAAA
            Chromosome:
            1:156677212
            Gene:
            NES (GeneView)
            Functional Consequence:
            missense
            Validated:
            no info
            HGVS:
            NC_000001.10:g.156647004C>T, NC_000001.11:g.156677212C>T, NG_012300.1:g.5186G>A, NM_006617.1:c.53G>A, NP_006608.1:p.Arg18His
            6.

            rs781565943 [Homo sapiens]
              TCCAGCCATCCCAGGAGGGCTTTCC[C/G/T]GAGCCAGTTCTTGGTCCTTCTCCAC
              Chromosome:
              1:156671300
              Gene:
              NES (GeneView)
              Functional Consequence:
              missense
              Validated:
              by frequency
              HGVS:
              NC_000001.10:g.156641092T>G, NC_000001.11:g.156671300T>C, NC_000001.11:g.156671300T>G, NG_012300.1:g.11098A>C, NG_012300.1:g.11098A>G, NM_006617.1:c.2888A>C, NM_006617.1:c.2888A>G, NP_006608.1:p.Gln963Arg, NP_006608.1:p.Gln963Pro
              7.

              rs781541049 [Homo sapiens]
                GCGCTCCTGGTAGCCGCGCACTGCC[A/C]CGCGCCACGCCTCGCCCAGTCGCCT
                Chromosome:
                1:156676702
                Gene:
                NES (GeneView)
                Functional Consequence:
                missense
                Validated:
                no info
                HGVS:
                NC_000001.10:g.156646494C>A, NC_000001.11:g.156676702C>A, NG_012300.1:g.5696G>T, NM_006617.1:c.563G>T, NP_006608.1:p.Gly188Val
                8.

                rs781512388 [Homo sapiens]
                  TTGCCTCCAAACTCTCCTCTTCCAG[A/G]GGTGGTTCCATCACCTCTTCCCTGG
                  Chromosome:
                  1:156670819
                  Gene:
                  NES (GeneView)
                  Functional Consequence:
                  synonymous codon
                  Validated:
                  by frequency
                  HGVS:
                  NC_000001.10:g.156640611G>A, NC_000001.11:g.156670819G>A, NG_012300.1:g.11579C>T, NM_006617.1:c.3369C>T, NP_006608.1:p.Pro1123
                  9.

                  rs781482356 [Homo sapiens]
                    AAGAGACTTCAGTGGTTCTAGATCC[A/C]CTTTTTCTGGGGGTCTTAATGTCAT
                    Chromosome:
                    1:156671840
                    Gene:
                    NES (GeneView)
                    Functional Consequence:
                    missense
                    Validated:
                    by frequency
                    HGVS:
                    NC_000001.10:g.156641632A>C, NC_000001.11:g.156671840A>C, NG_012300.1:g.10558T>G, NM_006617.1:c.2348T>G, NP_006608.1:p.Val783Gly
                    10.

                    rs781377929 [Homo sapiens]
                      GAGGCTGCCAACAGAAGACCCTGGC[C/T]CCCACCGCCCAGCCCCTGGCTCCCT
                      Chromosome:
                      1:156669875
                      Gene:
                      NES (GeneView)
                      Functional Consequence:
                      missense
                      Validated:
                      no info
                      HGVS:
                      NC_000001.10:g.156639667C>T, NC_000001.11:g.156669875C>T, NG_012300.1:g.12523G>A, NM_006617.1:c.4313G>A, NP_006608.1:p.Gly1438Glu
                      11.

                      rs781363592 [Homo sapiens]
                        AGGTCTCAGTGCCTCCTCATCCCCT[A/G]CTTCTGGAGATCTCAGTGGCTCTTG
                        Chromosome:
                        1:156672140
                        Gene:
                        NES (GeneView)
                        Functional Consequence:
                        missense
                        Validated:
                        no info
                        HGVS:
                        NC_000001.10:g.156641932A>G, NC_000001.11:g.156672140A>G, NG_012300.1:g.10258T>C, NM_006617.1:c.2048T>C, NP_006608.1:p.Val683Ala
                        12.

                        rs781342603 [Homo sapiens]
                          GAACTGACCCTGGCCCAGGTGAACA[A/G]GAGCCCCTGCCCAAGAGGTCTTCAG
                          Chromosome:
                          1:156669404
                          Gene:
                          NES (GeneView)
                          Functional Consequence:
                          missense
                          Validated:
                          no info
                          HGVS:
                          NC_000001.10:g.156639196G>A, NC_000001.11:g.156669404G>A, NG_012300.1:g.12994C>T, NM_006617.1:c.4784C>T, NP_006608.1:p.Pro1595Leu
                          13.

                          rs781257145 [Homo sapiens]
                            CCTGCCCCGGGCCTGGCTCAGCTCC[C/T]GCAGCAGACTCACCCATGGCAGGCT
                            Chromosome:
                            1:156670903
                            Gene:
                            NES (GeneView)
                            Functional Consequence:
                            synonymous codon
                            Validated:
                            by frequency
                            HGVS:
                            NC_000001.10:g.156640695C>T, NC_000001.11:g.156670903C>T, NG_012300.1:g.11495G>A, NM_006617.1:c.3285G>A, NP_006608.1:p.Ala1095
                            14.

                            rs781229243 [Homo sapiens]
                              CTGGAGATTTCAGTGTTTCCAGGTT[C/T]TCTTGTCCCGCAGACTTCAGTGATT
                              Chromosome:
                              1:156671683
                              Gene:
                              NES (GeneView)
                              Functional Consequence:
                              synonymous codon
                              Validated:
                              no info
                              HGVS:
                              NC_000001.10:g.156641475C>T, NC_000001.11:g.156671683C>T, NG_012300.1:g.10715G>A, NM_006617.1:c.2505G>A, NP_006608.1:p.Glu835
                              15.

                              rs781210376 [Homo sapiens]
                                CCTCCTCGTGCGCCACGCGTAGAGC[C/T]TCTAGCTCGCGCTCCAGCTCTGCCA
                                Chromosome:
                                1:156676851
                                Gene:
                                NES (GeneView)
                                Functional Consequence:
                                synonymous codon
                                Validated:
                                by frequency
                                HGVS:
                                NC_000001.10:g.156646643C>T, NC_000001.11:g.156676851C>T, NG_012300.1:g.5547G>A, NM_006617.1:c.414G>A, NP_006608.1:p.Glu138
                                16.

                                rs781140489 [Homo sapiens]
                                  TGTTTCTCCTGCTCCAGGGCCTCCA[C/T]AGCCAGCTGCAGGGCAGGCGAGAGG
                                  Chromosome:
                                  1:156675334
                                  Gene:
                                  NES (GeneView)
                                  Functional Consequence:
                                  missense
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000001.10:g.156645126C>T, NC_000001.11:g.156675334C>T, NG_012300.1:g.7064G>A, NM_006617.1:c.790G>A, NP_006608.1:p.Val264Met
                                  17.

                                  rs781031799 [Homo sapiens]
                                    CCCAGGGGCATCTTCCAGGATCGGG[A/G]TGTACGTTGGGCTGGGGGAGACCAG
                                    Chromosome:
                                    1:156670511
                                    Gene:
                                    NES (GeneView)
                                    Functional Consequence:
                                    missense
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000001.10:g.156640303G>A, NC_000001.11:g.156670511G>A, NG_012300.1:g.11887C>T, NM_006617.1:c.3677C>T, NP_006608.1:p.Thr1226Ile
                                    18.

                                    rs780998576 [Homo sapiens]
                                      AAATTCTTCTGACAGGTCAGAGTCA[C/T]GGCCACACTCCTCTTCTCCCTCCTC
                                      Chromosome:
                                      1:156670106
                                      Gene:
                                      NES (GeneView)
                                      Functional Consequence:
                                      missense
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000001.10:g.156639898C>T, NC_000001.11:g.156670106C>T, NG_012300.1:g.12292G>A, NM_006617.1:c.4082G>A, NP_006608.1:p.Arg1361His
                                      19.

                                      rs780851506 [Homo sapiens]
                                        TGTCCTCCCTCTCCAAGGAAACAGG[A/G/T]TCAGACTCTTCCTCTGAGCCAGAAG
                                        Chromosome:
                                        1:156669679
                                        Gene:
                                        NES (GeneView)
                                        Functional Consequence:
                                        missense,synonymous codon
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000001.10:g.156639471G>A, NC_000001.10:g.156639471G>T, NC_000001.11:g.156669679G>A, NC_000001.11:g.156669679G>T, NG_012300.1:g.12719C>A, NG_012300.1:g.12719C>T, NM_006617.1:c.4509C>A, NM_006617.1:c.4509C>T, NP_006608.1:p.Asp1503, NP_006608.1:p.Asp1503Glu
                                        20.

                                        rs780832107 [Homo sapiens]
                                          TTCAGGGTTTCTTTTTCCAAAGGAA[C/T]CTGGGAGTCCTGGATTTCCTTCCTG
                                          Chromosome:
                                          1:156672573
                                          Gene:
                                          NES (GeneView)
                                          Functional Consequence:
                                          missense
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000001.10:g.156642365C>T, NC_000001.11:g.156672573C>T, NG_012300.1:g.9825G>A, NM_006617.1:c.1615G>A, NP_006608.1:p.Val539Ile

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center