Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 138

1.

rs781692599 [Homo sapiens]
    CGGGACTTACTGTGGTTGCAGTAAA[A/G]GGTGATAACCAGTGACAGGAGAAGG
    Chromosome:
    2:86789338
    Gene:
    CD8A (GeneView)
    Functional Consequence:
    intron variant,missense,nc transcript variant
    Validated:
    no info
    HGVS:
    NC_000002.11:g.87016461G>A, NC_000002.12:g.86789338G>A, NG_011608.2:g.24059C>T, NM_001145873.1:c.610C>T, NM_001768.6:c.610C>T, NM_171827.3:c.514+302C>T, NP_001139345.1:p.Leu204Phe, NP_001759.3:p.Leu204Phe, NR_027353.1:n.1085C>T
    2.

    rs780843834 [Homo sapiens]
      CCGCAACCCGGCGCGCGGACCTGGC[A/G]GGAAGACCGGCACGAAGTGGCTGAA
      Chromosome:
      2:86790333
      Gene:
      CD8A (GeneView)
      Functional Consequence:
      missense,nc transcript variant
      Validated:
      no info
      HGVS:
      NC_000002.11:g.87017456A>G, NC_000002.12:g.86790333A>G, NG_011608.2:g.23064T>C, NM_001145873.1:c.398T>C, NM_001768.6:c.398T>C, NM_171827.3:c.398T>C, NP_001139345.1:p.Leu133Pro, NP_001759.3:p.Leu133Pro, NP_741969.1:p.Leu133Pro, NR_027353.1:n.873T>C
      3.

      rs780835924 [Homo sapiens]
        GCAGAAATAGTAGCCCTCGTTCTCT[C/T]GGCGGAAGTCGCTCAGGGTGAGGAC
        Chromosome:
        2:86790411
        Gene:
        CD8A (GeneView)
        Functional Consequence:
        missense,nc transcript variant
        Validated:
        by frequency
        HGVS:
        NC_000002.11:g.87017534C>T, NC_000002.12:g.86790411C>T, NG_011608.2:g.22986G>A, NM_001145873.1:c.320G>A, NM_001768.6:c.320G>A, NM_171827.3:c.320G>A, NP_001139345.1:p.Arg107Gln, NP_001759.3:p.Arg107Gln, NP_741969.1:p.Arg107Gln, NR_027353.1:n.795G>A
        4.

        rs780004271 [Homo sapiens]
          AGCCCTCGTTCTCTCGGCGGAAGTC[A/G]CTCAGGGTGAGGACGAAGGTGTCCC
          Chromosome:
          2:86790422
          Gene:
          CD8A (GeneView)
          Functional Consequence:
          nc transcript variant,synonymous codon
          Validated:
          no info
          HGVS:
          NC_000002.11:g.87017545G>A, NC_000002.12:g.86790422G>A, NG_011608.2:g.22975C>T, NM_001145873.1:c.309C>T, NM_001768.6:c.309C>T, NM_171827.3:c.309C>T, NP_001139345.1:p.Ser103, NP_001759.3:p.Ser103, NP_741969.1:p.Ser103, NR_027353.1:n.784C>T
          5.

          rs779814071 [Homo sapiens]
            CGCTGGGTGTCCAGCCCCTCGGCCG[C/T]CTTGGGCTTGTTTTGGGAGAGGTAT
            Chromosome:
            2:86790493
            Gene:
            CD8A (GeneView)
            Functional Consequence:
            missense,nc transcript variant
            Validated:
            by frequency
            HGVS:
            NC_000002.11:g.87017616C>T, NC_000002.12:g.86790493C>T, NG_011608.2:g.22904G>A, NM_001145873.1:c.238G>A, NM_001768.6:c.238G>A, NM_171827.3:c.238G>A, NP_001139345.1:p.Ala80Thr, NP_001759.3:p.Ala80Thr, NP_741969.1:p.Ala80Thr, NR_027353.1:n.713G>A
            6.

            rs778854751 [Homo sapiens]
              CTGGAAGAGCCACGAGCAGCCCGAC[A/G]TCGGGTTGGACAGCAGCACCTGGCA
              Chromosome:
              2:86790579
              Gene:
              CD8A (GeneView)
              Functional Consequence:
              missense,nc transcript variant
              Validated:
              no info
              HGVS:
              NC_000002.11:g.87017702G>A, NC_000002.12:g.86790579G>A, NG_011608.2:g.22818C>T, NM_001145873.1:c.152C>T, NM_001768.6:c.152C>T, NM_171827.3:c.152C>T, NP_001139345.1:p.Thr51Met, NP_001759.3:p.Thr51Met, NP_741969.1:p.Thr51Met, NR_027353.1:n.627C>T
              7.

              rs778769116 [Homo sapiens]
                GCCGCCTTGGGCTTGTTTTGGGAGA[C/G]GTATAGGAGGAAGGTGGGACTGGCG
                Chromosome:
                2:86790514
                Gene:
                CD8A (GeneView)
                Functional Consequence:
                missense,nc transcript variant
                Validated:
                by frequency
                HGVS:
                NC_000002.11:g.87017637G>C, NC_000002.12:g.86790514G>C, NG_011608.2:g.22883C>G, NM_001145873.1:c.217C>G, NM_001768.6:c.217C>G, NM_171827.3:c.217C>G, NP_001139345.1:p.Leu73Val, NP_001759.3:p.Leu73Val, NP_741969.1:p.Leu73Val, NR_027353.1:n.692C>G
                8.

                rs778658857 [Homo sapiens]
                  TAATGTAGTGGCTGTTGCACAGGGT[G/T]AGACGTATCTCGCCGAAAGGCTGGG
                  Chromosome:
                  2:86785921
                  Gene:
                  CD8A (GeneView)
                  Functional Consequence:
                  nc transcript variant,stop lost
                  Validated:
                  no info
                  HGVS:
                  NC_000002.11:g.87013044T>G, NC_000002.12:g.86785921T>G, NG_011608.2:g.27476A>C, NM_001145873.1:c.707A>C, NM_001768.6:c.707A>C, NM_171827.3:c.596A>C, NP_001139345.1:p.Ter236Ser, NP_001759.3:p.Ter236Ser, NP_741969.1:p.Ter199Ser, NR_027353.1:n.1182A>C
                  9.

                  rs777829827 [Homo sapiens]
                    GTCGCTCAGGGTGAGGACGAAGGTG[A/T]CCCCCAACCTCTTGCCCGAGAACCG
                    Chromosome:
                    2:86790444
                    Gene:
                    CD8A (GeneView)
                    Functional Consequence:
                    missense,nc transcript variant
                    Validated:
                    no info
                    HGVS:
                    NC_000002.11:g.87017567T>A, NC_000002.12:g.86790444T>A, NG_011608.2:g.22953A>T, NM_001145873.1:c.287A>T, NM_001768.6:c.287A>T, NM_171827.3:c.287A>T, NP_001139345.1:p.Asp96Val, NP_001759.3:p.Asp96Val, NP_741969.1:p.Asp96Val, NR_027353.1:n.762A>T
                    10.

                    rs777708130 [Homo sapiens]
                      TTGCACAGGGTTAGACGTATCTCGC[C/T]GAAAGGCTGGGCTTGTCTCCCGATT
                      Chromosome:
                      2:86785935
                      Gene:
                      CD8A (GeneView)
                      Functional Consequence:
                      nc transcript variant,synonymous codon
                      Validated:
                      no info
                      HGVS:
                      NC_000002.11:g.87013058C>T, NC_000002.12:g.86785935C>T, NG_011608.2:g.27462G>A, NM_001145873.1:c.693G>A, NM_001768.6:c.693G>A, NM_171827.3:c.582G>A, NP_001139345.1:p.Ser231, NP_001759.3:p.Ser231, NP_741969.1:p.Ser194, NR_027353.1:n.1168G>A
                      11.

                      rs777645171 [Homo sapiens]
                        AAAGGGTGATAACCAGTGACAGGAG[A/G]AGGACCCCACAAGTCCCGGCCAAGG
                        Chromosome:
                        2:86789360
                        Gene:
                        CD8A (GeneView)
                        Functional Consequence:
                        intron variant,nc transcript variant,synonymous codon
                        Validated:
                        no info
                        HGVS:
                        NC_000002.11:g.87016483A>G, NC_000002.12:g.86789360A>G, NG_011608.2:g.24037T>C, NM_001145873.1:c.588T>C, NM_001768.6:c.588T>C, NM_171827.3:c.514+280T>C, NP_001139345.1:p.Leu196, NP_001759.3:p.Leu196, NR_027353.1:n.1063T>C
                        13.

                        rs776195299 [Homo sapiens]
                          CGAAGGTGTCCCCCAACCTCTTGCC[C/T]GAGAACCGCTGGGTGTCCAGCCCCT
                          Chromosome:
                          2:86790461
                          Gene:
                          CD8A (GeneView)
                          Functional Consequence:
                          nc transcript variant,synonymous codon
                          Validated:
                          no info
                          HGVS:
                          NC_000002.11:g.87017584C>T, NC_000002.12:g.86790461C>T, NG_011608.2:g.22936G>A, NM_001145873.1:c.270G>A, NM_001768.6:c.270G>A, NM_171827.3:c.270G>A, NP_001139345.1:p.Ser90, NP_001759.3:p.Ser90, NP_741969.1:p.Ser90, NR_027353.1:n.745G>A
                          15.

                          rs775080990 [Homo sapiens]
                            AAAAGAGACTCACCGGGGACATTTG[C/T]AAACACGTCTTCGGTTCCCTGGATA
                            Chromosome:
                            2:86788542
                            Gene:
                            CD8A (GeneView)
                            Functional Consequence:
                            missense,nc transcript variant
                            Validated:
                            no info
                            HGVS:
                            NC_000002.11:g.87015665C>T, NC_000002.12:g.86788542C>T, NG_011608.2:g.24855G>A, NM_001145873.1:c.644G>A, NM_001768.6:c.644G>A, NM_171827.3:c.533G>A, NP_001139345.1:p.Cys215Tyr, NP_001759.3:p.Cys215Tyr, NP_741969.1:p.Cys178Tyr, NR_027353.1:n.1119G>A
                            16.

                            rs774972608 [Homo sapiens]
                              GGGTGATAACCAGTGACAGGAGAAG[A/G]ACCCCACAAGTCCCGGCCAAGGGCG
                              Chromosome:
                              2:86789363
                              Gene:
                              CD8A (GeneView)
                              Functional Consequence:
                              intron variant,nc transcript variant,synonymous codon
                              Validated:
                              no info
                              HGVS:
                              NC_000002.11:g.87016486G>A, NC_000002.12:g.86789363G>A, NG_011608.2:g.24034C>T, NM_001145873.1:c.585C>T, NM_001768.6:c.585C>T, NM_171827.3:c.514+277C>T, NP_001139345.1:p.Val195, NP_001759.3:p.Val195, NR_027353.1:n.1060C>T
                              17.

                              rs774849270 [Homo sapiens]
                                CCGAAAGGCTGGGCTTGTCTCCCGA[G/T]TTGACCACAGGCCTGAAAGAGAGGA
                                Chromosome:
                                2:86785959
                                Gene:
                                CD8A (GeneView)
                                Functional Consequence:
                                missense,nc transcript variant
                                Validated:
                                no info
                                HGVS:
                                NC_000002.11:g.87013082T>G, NC_000002.12:g.86785959T>G, NG_011608.2:g.27438A>C, NM_001145873.1:c.669A>C, NM_001768.6:c.669A>C, NM_171827.3:c.558A>C, NP_001139345.1:p.Lys223Asn, NP_001759.3:p.Lys223Asn, NP_741969.1:p.Lys186Asn, NR_027353.1:n.1144A>C
                                19.

                                rs773336563 [Homo sapiens]
                                  CGGCCAAGGGCGCCCAGATGTAGAT[A/G]TCACAGGCGAAGTCCAGCCCCCTCG
                                  Chromosome:
                                  2:86789402
                                  Gene:
                                  CD8A (GeneView)
                                  Functional Consequence:
                                  intron variant,nc transcript variant,synonymous codon
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000002.11:g.87016525A>G, NC_000002.12:g.86789402A>G, NG_011608.2:g.23995T>C, NM_001145873.1:c.546T>C, NM_001768.6:c.546T>C, NM_171827.3:c.514+238T>C, NP_001139345.1:p.Asp182, NP_001759.3:p.Asp182, NR_027353.1:n.1021T>C
                                  20.

                                  rs771963865 [Homo sapiens]
                                    AGTCCCGGCCAAGGGCGCCCAGATG[C/T]AGATATCACAGGCGAAGTCCAGCCC
                                    Chromosome:
                                    2:86789397
                                    Gene:
                                    CD8A (GeneView)
                                    Functional Consequence:
                                    intron variant,missense,nc transcript variant
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000002.11:g.87016520T>C, NC_000002.12:g.86789397T>C, NG_011608.2:g.24000A>G, NM_001145873.1:c.551A>G, NM_001768.6:c.551A>G, NM_171827.3:c.514+243A>G, NP_001139345.1:p.Tyr184Cys, NP_001759.3:p.Tyr184Cys, NR_027353.1:n.1026A>G

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center