Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 1950

1.

rs781667205 [Homo sapiens]
    TGTCTGCCAAATATGACAGGGAAGA[A/C]ATATAGGAAGGACCATCTGAAATAT
    Chromosome:
    8:47859743
    Gene:
    PRKDC (GeneView)
    Functional Consequence:
    missense
    Validated:
    by frequency
    HGVS:
    NC_000008.10:g.48772304C>A, NC_000008.11:g.47859743C>A, NG_023435.1:g.105441G>T, NM_001081640.1:c.6075G>T, NM_006904.6:c.6075G>T, NP_001075109.1:p.Met2025Ile, NP_008835.5:p.Met2025Ile
    2.

    rs781660365 [Homo sapiens]
      GGGTAGTTATCAGTGATTTCTTCCA[C/G]AGAGTGCTGAACAGCAACGGCTTGG
      Chromosome:
      8:47794408
      Gene:
      PRKDC (GeneView)
      Functional Consequence:
      missense
      Validated:
      by frequency
      HGVS:
      NC_000008.10:g.48706969C>G, NC_000008.11:g.47794408C>G, NG_023435.1:g.170776G>C, NM_001081640.1:c.10552G>C, NM_006904.6:c.10552G>C, NP_001075109.1:p.Val3518Leu, NP_008835.5:p.Val3518Leu
      3.
      4.

      rs781624012 [Homo sapiens]
        CTTCCAGCACTCGACAAGGGTCTTT[A/G]TAATTTCAAGGTTGTGTCTAAACAC
        Chromosome:
        8:47855270
        Gene:
        PRKDC (GeneView)
        Functional Consequence:
        missense
        Validated:
        by frequency
        HGVS:
        NC_000008.10:g.48767831A>G, NC_000008.11:g.47855270A>G, NG_023435.1:g.109914T>C, NM_001081640.1:c.6713T>C, NM_006904.6:c.6713T>C, NP_001075109.1:p.Ile2238Thr, NP_008835.5:p.Ile2238Thr
        5.

        rs781610542 [Homo sapiens]
          TGGGTCTCTAGGATATCTTTGTATG[A/G]GGACATCTTTAGAGCTTTCATCAGA
          Chromosome:
          8:47889066
          Gene:
          PRKDC (GeneView)
          Functional Consequence:
          missense
          Validated:
          no info
          HGVS:
          NC_000008.10:g.48801627G>A, NC_000008.11:g.47889066G>A, NG_023435.1:g.76118C>T, NM_001081640.1:c.4228C>T, NM_006904.6:c.4228C>T, NP_001075109.1:p.Pro1410Ser, NP_008835.5:p.Pro1410Ser
          6.

          rs781530600 [Homo sapiens]
            GACCGATGAAAAAAATTACCTTGTT[C/T]GCTTATAAAGCTGATGAACTCCTGA
            Chromosome:
            8:47819408
            Gene:
            PRKDC (GeneView)
            Functional Consequence:
            missense
            Validated:
            by frequency
            HGVS:
            NC_000008.10:g.48731969T>C, NC_000008.11:g.47819408T>C, NG_023435.1:g.145776A>G, NM_001081640.1:c.9439A>G, NM_006904.6:c.9439A>G, NP_001075109.1:p.Lys3147Glu, NP_008835.5:p.Lys3147Glu
            7.

            rs781401034 [Homo sapiens]
              AGAAACATGCTTCTTTTCAATGATG[C/T]GGCATAGGTGATCAATGGCATCACA
              Chromosome:
              8:47898527
              Gene:
              PRKDC (GeneView)
              Functional Consequence:
              missense
              Validated:
              by cluster,by frequency
              HGVS:
              NC_000008.10:g.48811087C>T, NC_000008.11:g.47898527C>T, NG_023435.1:g.66657G>A, NM_001081640.1:c.3407G>A, NM_006904.6:c.3407G>A, NP_001075109.1:p.Arg1136His, NP_008835.5:p.Arg1136His
              8.

              rs781359295 [Homo sapiens]
                CTGAAGAGATCCACGTAGTCTTTGT[A/G]TGTGGGCACCTTCCATTTGCCAGTT
                Chromosome:
                8:47934018
                Gene:
                PRKDC (GeneView)
                Functional Consequence:
                missense
                Validated:
                by frequency
                HGVS:
                NC_000008.10:g.48846578A>G, NC_000008.11:g.47934018A>G, NG_023435.1:g.31166T>C, NM_001081640.1:c.1570T>C, NM_006904.6:c.1570T>C, NP_001075109.1:p.Tyr524His, NP_008835.5:p.Tyr524His
                9.

                rs781350414 [Homo sapiens]
                  ATTTTTAAAAGTAGCATGTTGGTAA[A/T]GTCGTTGAAGTCACTGAGCTTCATT
                  Chromosome:
                  8:47785236
                  Gene:
                  PRKDC (GeneView)
                  Functional Consequence:
                  missense
                  Validated:
                  no info
                  HGVS:
                  NC_000008.10:g.48697797T>A, NC_000008.11:g.47785236T>A, NG_023435.1:g.179948A>T, NM_001081640.1:c.10984A>T, NM_006904.6:c.10984A>T, NP_001075109.1:p.Ile3662Phe, NP_008835.5:p.Ile3662Phe
                  10.

                  rs781344880 [Homo sapiens]
                    CCCTGAAGCTCTGGTCTAACATGCC[A/G]TTCAAAACGGCACTCACCTGAGACA
                    Chromosome:
                    8:47882080
                    Gene:
                    PRKDC (GeneView)
                    Functional Consequence:
                    synonymous codon
                    Validated:
                    by frequency
                    HGVS:
                    NC_000008.10:g.48794641G>A, NC_000008.11:g.47882080G>A, NG_023435.1:g.83104C>T, NM_001081640.1:c.4794C>T, NM_006904.6:c.4794C>T, NP_001075109.1:p.Asn1598, NP_008835.5:p.Asn1598
                    11.

                    rs781285391 [Homo sapiens]
                      GTTTTCCTGACATTTTTGTCAGCCA[A/G]TCTTTATATTCACACGGCGGTGCCC
                      Chromosome:
                      8:47779060
                      Gene:
                      PRKDC (GeneView)
                      Functional Consequence:
                      synonymous codon
                      Validated:
                      no info
                      HGVS:
                      NC_000008.10:g.48691621A>G, NC_000008.11:g.47779060A>G, NG_023435.1:g.186124T>C, NM_001081640.1:c.11430T>C, NM_006904.6:c.11523T>C, NP_001075109.1:p.Asp3810, NP_008835.5:p.Asp3841
                      12.

                      rs781279955 [Homo sapiens]
                        GGATCCCATTCATGACCTGGAAGAG[C/T]TGCTCCACGCGCTGGTCCTGCCGCA
                        Chromosome:
                        8:47782476
                        Gene:
                        PRKDC (GeneView)
                        Functional Consequence:
                        synonymous codon
                        Validated:
                        no info
                        HGVS:
                        NC_000008.10:g.48695037C>T, NC_000008.11:g.47782476C>T, NG_023435.1:g.182708G>A, NM_001081640.1:c.11298G>A, NM_006904.6:c.11298G>A, NP_001075109.1:p.Gln3766, NP_008835.5:p.Gln3766
                        13.

                        rs781275979 [Homo sapiens]
                          TCCTGACTTTCAAATTTCTTGTTGT[G/T]AGTGAACCAGTGAATCAGCTGCATA
                          Chromosome:
                          8:47904922
                          Gene:
                          PRKDC (GeneView)
                          Functional Consequence:
                          missense
                          Validated:
                          no info
                          HGVS:
                          NC_000008.10:g.48817482T>G, NC_000008.11:g.47904922T>G, NG_023435.1:g.60262A>C, NM_001081640.1:c.2989A>C, NM_006904.6:c.2989A>C, NP_001075109.1:p.Asn997His, NP_008835.5:p.Asn997His
                          14.

                          rs781263914 [Homo sapiens]
                            TCACTGCTGAGAGCATTCGCTATGA[C/T]CCTGTAAGTTGTACCCAAGAGAATG
                            Chromosome:
                            8:47800903
                            Gene:
                            PRKDC (GeneView)
                            Functional Consequence:
                            missense
                            Validated:
                            no info
                            HGVS:
                            NC_000008.10:g.48713464T>C, NC_000008.11:g.47800903T>C, NG_023435.1:g.164281A>G, NM_001081640.1:c.10006A>G, NM_006904.6:c.10006A>G, NP_001075109.1:p.Ile3336Val, NP_008835.5:p.Ile3336Val
                            15.

                            rs781253650 [Homo sapiens]
                              ACACCTTCACTATGGCTCTGCAACA[A/C]ACCAGCTGCATTTTTGGACTGTACT
                              Chromosome:
                              8:47935811
                              Gene:
                              PRKDC (GeneView)
                              Functional Consequence:
                              synonymous codon
                              Validated:
                              no info
                              HGVS:
                              NC_000008.10:g.48848371C>A, NC_000008.11:g.47935811C>A, NG_023435.1:g.29373G>T, NM_001081640.1:c.1368G>T, NM_006904.6:c.1368G>T, NP_001075109.1:p.Val456, NP_008835.5:p.Val456
                              16.

                              rs781249086 [Homo sapiens]
                                GTATAGCTCAGGCCCAGTTTGAAAG[C/T]CATCTGTATGTTAATACAAACAAGT
                                Chromosome:
                                8:47927350
                                Gene:
                                PRKDC (GeneView)
                                Functional Consequence:
                                missense
                                Validated:
                                no info
                                HGVS:
                                NC_000008.10:g.48839910C>T, NC_000008.11:g.47927350C>T, NG_023435.1:g.37834G>A, NM_001081640.1:c.2263G>A, NM_006904.6:c.2263G>A, NP_001075109.1:p.Ala755Thr, NP_008835.5:p.Ala755Thr
                                18.

                                rs781199554 [Homo sapiens]
                                  TCAGGCACTTCACTTGAGTCTCTTC[C/T]GAAAGCCCACTCTCTGGTTCTTGGG
                                  Chromosome:
                                  8:47774263
                                  Gene:
                                  PRKDC (GeneView)
                                  Functional Consequence:
                                  synonymous codon
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000008.10:g.48686824T>C, NC_000008.11:g.47774263T>C, NG_023435.1:g.190921A>G, NM_001081640.1:c.12204A>G, NM_006904.6:c.12297A>G, NP_001075109.1:p.Ser4068, NP_008835.5:p.Ser4099
                                  19.

                                  rs781184930 [Homo sapiens]
                                    ATGAATAGCTCTGAACTCCGGTTGA[A/G]AAATCAAATTGACTCATTTCCTCAC
                                    Chromosome:
                                    8:47859683
                                    Gene:
                                    PRKDC (GeneView)
                                    Functional Consequence:
                                    synonymous codon
                                    Validated:
                                    by frequency
                                    HGVS:
                                    NC_000008.10:g.48772244G>A, NC_000008.11:g.47859683G>A, NG_023435.1:g.105501C>T, NM_001081640.1:c.6135C>T, NM_006904.6:c.6135C>T, NP_001075109.1:p.Phe2045, NP_008835.5:p.Phe2045
                                    20.

                                    rs781150369 [Homo sapiens]
                                      TATTACCTTCTCTGAATCCTCTGAA[C/T]TGGATCCAGAAAGCTCTAAGATTCT
                                      Chromosome:
                                      8:47800812
                                      Gene:
                                      PRKDC (GeneView)
                                      Functional Consequence:
                                      missense
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000008.10:g.48713373C>T, NC_000008.11:g.47800812C>T, NG_023435.1:g.164372G>A, NM_001081640.1:c.10097G>A, NM_006904.6:c.10097G>A, NP_001075109.1:p.Ser3366Asn, NP_008835.5:p.Ser3366Asn

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center