Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 128

1.
2.

rs781607647 [Homo sapiens]
    TGCAGGACATGACAACTCATCTCAT[C/T]CTGCGCAGCTTTAAGGAGTTCCTGC
    Chromosome:
    7:22731516
    Gene:
    IL6 (GeneView)
    Functional Consequence:
    downstream variant 500B,synonymous codon
    Validated:
    no info
    HGVS:
    NC_000007.13:g.22771135T>C, NC_000007.14:g.22731516T>C, NG_011640.1:g.9370T>C, NM_000600.4:c.582T>C, NM_001318095.1:c.354T>C, NP_000591.1:p.Ile194, NP_001305024.1:p.Ile118, XM_005249745.4:c.*1730T>C, XM_005249746.1:c.354T>C, XM_011515390.2:c.582T>C, XP_005249803.1:p.Ile118, XP_011513692.1:p.Ile194
    4.
    5.
    7.

    rs778926078 [Homo sapiens]
      CACAGAACCAGTGGCTGCAGGACAT[A/G]ACAACTCATCTCATTCTGCGCAGCT
      Chromosome:
      7:22731501
      Gene:
      IL6 (GeneView)
      Functional Consequence:
      downstream variant 500B,missense
      Validated:
      no info
      HGVS:
      NC_000007.13:g.22771120G>A, NC_000007.14:g.22731501G>A, NG_011640.1:g.9355G>A, NM_000600.4:c.567G>A, NM_001318095.1:c.339G>A, NP_000591.1:p.Met189Ile, NP_001305024.1:p.Met113Ile, XM_005249745.4:c.*1715G>A, XM_005249746.1:c.339G>A, XM_011515390.2:c.567G>A, XP_005249803.1:p.Met113Ile, XP_011513692.1:p.Met189Ile
      8.

      rs778836162 [Homo sapiens]
        TTCCTTCAGGCAAAGAATCTAGATG[C/T]AATAACCACCCCTGACCCAACCACA
        Chromosome:
        7:22731422
        Gene:
        IL6 (GeneView)
        Functional Consequence:
        downstream variant 500B,missense
        Validated:
        no info
        HGVS:
        NC_000007.13:g.22771041C>T, NC_000007.14:g.22731422C>T, NG_011640.1:g.9276C>T, NM_000600.4:c.488C>T, NM_001318095.1:c.260C>T, NP_000591.1:p.Ala163Val, NP_001305024.1:p.Ala87Val, XM_005249745.4:c.*1636C>T, XM_005249746.1:c.260C>T, XM_011515390.2:c.488C>T, XP_005249803.1:p.Ala87Val, XP_011513692.1:p.Ala163Val
        10.
        11.
        13.

        rs775912118 [Homo sapiens]
          AGATGCAATAACCACCCCTGACCCA[A/G]CCACAAATGCCAGCCTGCTGACGAA
          Chromosome:
          7:22731442
          Gene:
          IL6 (GeneView)
          Functional Consequence:
          downstream variant 500B,missense
          Validated:
          no info
          HGVS:
          NC_000007.13:g.22771061A>G, NC_000007.14:g.22731442A>G, NG_011640.1:g.9296A>G, NM_000600.4:c.508A>G, NM_001318095.1:c.280A>G, NP_000591.1:p.Thr170Ala, NP_001305024.1:p.Thr94Ala, XM_005249745.4:c.*1656A>G, XM_005249746.1:c.280A>G, XM_011515390.2:c.508A>G, XP_005249803.1:p.Thr94Ala, XP_011513692.1:p.Thr170Ala
          14.
          15.

          rs774788213 [Homo sapiens]
            AGGAGTTCCTGCAGTCCAGCCTGAG[A/G]GCTCTTCGGCAAATGTAGCATGGGC
            Chromosome:
            7:22731555
            Gene:
            IL6 (GeneView)
            Functional Consequence:
            downstream variant 500B,synonymous codon
            Validated:
            no info
            HGVS:
            NC_000007.13:g.22771174G>A, NC_000007.14:g.22731555G>A, NG_011640.1:g.9409G>A, NM_000600.4:c.621G>A, NM_001318095.1:c.393G>A, NP_000591.1:p.Arg207, NP_001305024.1:p.Arg131, XM_005249745.4:c.*1769G>A, XM_005249746.1:c.393G>A, XM_011515390.2:c.621G>A, XP_005249803.1:p.Arg131, XP_011513692.1:p.Arg207
            16.

            rs774472593 [Homo sapiens]
              CAGACAGCCACTCACCTCTTCAGAA[A/C]GAATTGACAAACAAATTCGGTACAT
              Chromosome:
              7:22727578
              Gene:
              IL6 (GeneView) LOC541472 (GeneView)
              Functional Consequence:
              intron variant,nc transcript variant,synonymous codon
              Validated:
              by frequency
              HGVS:
              NC_000007.13:g.22767197C>A, NC_000007.14:g.22727578C>A, NG_011640.1:g.5432C>A, NM_000600.4:c.154C>A, NM_001318095.1:c.-19+297C>A, NP_000591.1:p.Arg52, NR_131935.1:n.43G>T, XM_005249745.1:c.316C>A, XM_005249745.4:c.316C>A, XM_005249746.1:c.-19+297C>A, XM_011515390.2:c.154C>A, XP_005249802.1:p.Arg106, XP_011513692.1:p.Arg52
              17.

              rs774003579 [Homo sapiens]
                AGCCCAGCTATGAACTCCTTCTCCA[C/T]AAGTAAGTGCAGGAAATCCTTAGCC
                Chromosome:
                7:22727279
                Gene:
                IL6 (GeneView) LOC541472 (GeneView)
                Functional Consequence:
                intron variant,missense,utr variant 5 prime
                Validated:
                no info
                HGVS:
                NC_000007.13:g.22766898C>T, NC_000007.14:g.22727279C>T, NG_011640.1:g.5133C>T, NM_000600.4:c.17C>T, NM_001318095.1:c.-21C>T, NP_000591.1:p.Thr6Ile, NR_131935.1:n.53+289G>A, XM_005249745.1:c.17C>T, XM_005249745.4:c.17C>T, XM_005249746.1:c.-21C>T, XM_011515390.2:c.17C>T, XP_005249802.1:p.Thr6Ile, XP_011513692.1:p.Thr6Ile
                19.

                rs771953345 [Homo sapiens]
                  GCTGCAGGACATGACAACTCATCTC[A/G]TTCTGCGCAGCTTTAAGGAGTTCCT
                  Chromosome:
                  7:22731514
                  Gene:
                  IL6 (GeneView)
                  Functional Consequence:
                  downstream variant 500B,missense
                  Validated:
                  no info
                  HGVS:
                  NC_000007.13:g.22771133A>G, NC_000007.14:g.22731514A>G, NG_011640.1:g.9368A>G, NM_000600.4:c.580A>G, NM_001318095.1:c.352A>G, NP_000591.1:p.Ile194Val, NP_001305024.1:p.Ile118Val, XM_005249745.4:c.*1728A>G, XM_005249746.1:c.352A>G, XM_011515390.2:c.580A>G, XP_005249803.1:p.Ile118Val, XP_011513692.1:p.Ile194Val

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Support Center