Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 43

1.

rs780744512 [Homo sapiens]
    TGAGAATTTTGACTTTGCATTCTGT[C/T]GGAATACTTGTGTTCAATAAAAATT
    Chromosome:
    11:113278396
    Gene:
    LOC105369499 (GeneView) NCAM1 (GeneView)
    Functional Consequence:
    downstream variant 500B,nc transcript variant,utr variant 3 prime
    Validated:
    by cluster
    HGVS:
    CM000673.2:g.113278396C>T, NC_000011.10:g.113278396C>T, NC_000011.9:g.113149118C>T, NG_032036.1:g.322150C>T, NM_000615.6:c.*3009C>T, NM_001242607.1:c.*3009C>T, NM_181351.4:c.*3009C>T, NW_003871078.1:g.461122C>T, XR_001748388.1:n.812G>A, XR_001748389.1:n.1513G>A
    3.

    rs765440959 [Homo sapiens]
      AAAAAAAAAAAGCAATGCTTTCTCT[-/A]AAAATCAAAGAGGGAGTCATTTTAT
      Chromosome:
      11:113277890
      Gene:
      LOC105369499 (GeneView) NCAM1 (GeneView)
      Functional Consequence:
      downstream variant 500B,utr variant 3 prime
      Validated:
      by cluster
      HGVS:
      CM000673.2:g.113277890_113277891insA, NC_000011.10:g.113277890_113277891insA, NC_000011.9:g.113148612_113148613insA, NG_032036.1:g.321644_321645insA, NM_000615.6:c.*2503_*2504insA, NM_001242607.1:c.*2503_*2504insA, NM_181351.4:c.*2503_*2504insA, NW_003871078.1:g.460616_460617insA, XR_001748388.1:n.1317_1318insT
      4.

      rs763253119 [Homo sapiens]
        AAACACACAGAGCCCAACGAGACCA[C/T]GCCACTGACGGAGCCCGAGTACGTG
        Chromosome:
        11:113271858
        Gene:
        NCAM1-AS1 (GeneView) NCAM1 (GeneView)
        Functional Consequence:
        intron variant,missense
        Validated:
        by cluster
        HGVS:
        CM000673.2:g.113271858C>T, NC_000011.10:g.113271858C>T, NC_000011.9:g.113142580C>T, NG_032036.1:g.315612C>T, NM_000615.6:c.2408C>T, NM_001242607.1:c.2516C>T, NM_181351.4:c.2438C>T, NP_000606.3:p.Thr803Met, NP_001229536.1:p.Thr839Met, NP_851996.2:p.Thr813Met, NR_034101.1:n.279-1337G>A, NW_003871078.1:g.454584C>T
        5.

        rs759841287 [Homo sapiens]
          AAAAAAAAAAAAAAGCAATGCTTTC[A/T]CTAAAATCAAAGAGGGAGTCATTTT
          Chromosome:
          11:113277888
          Gene:
          LOC105369499 (GeneView) NCAM1 (GeneView)
          Functional Consequence:
          downstream variant 500B,utr variant 3 prime
          Validated:
          no info
          HGVS:
          CM000673.2:g.113277888T>A, NC_000011.10:g.113277888T>A, NC_000011.9:g.113148610T>A, NG_032036.1:g.321642T>A, NM_000615.6:c.*2501T>A, NM_001242607.1:c.*2501T>A, NM_181351.4:c.*2501T>A, NW_003871078.1:g.460614T>A, XR_001748388.1:n.1320A>T
          6.

          rs758170324 [Homo sapiens]
            CAACTCCAGTTTCCAATGTCTATGT[A/G]TCTATGTGTGTATGTGCCATACATA
            Chromosome:
            11:113278014
            Gene:
            LOC105369499 (GeneView) NCAM1 (GeneView)
            Functional Consequence:
            downstream variant 500B,utr variant 3 prime
            Validated:
            by cluster
            HGVS:
            CM000673.2:g.113278014G>A, NC_000011.10:g.113278014G>A, NC_000011.9:g.113148736G>A, NG_032036.1:g.321768G>A, NM_000615.6:c.*2627G>A, NM_001242607.1:c.*2627G>A, NM_181351.4:c.*2627G>A, NW_003871078.1:g.460740G>A, XR_001748388.1:n.1194C>T
            7.

            rs751544935 [Homo sapiens]
              TATGTATTCACATGAAGACCGGCAT[A/G]GCCAAGTTCTGCTGGAGGAGCACTC
              Chromosome:
              11:113278063
              Gene:
              LOC105369499 (GeneView) NCAM1 (GeneView)
              Functional Consequence:
              downstream variant 500B,utr variant 3 prime
              Validated:
              no info
              HGVS:
              CM000673.2:g.113278063G>A, NC_000011.10:g.113278063G>A, NC_000011.9:g.113148785G>A, NG_032036.1:g.321817G>A, NM_000615.6:c.*2676G>A, NM_001242607.1:c.*2676G>A, NM_181351.4:c.*2676G>A, NW_003871078.1:g.460789G>A, XR_001748388.1:n.1145C>T, XR_001748389.1:n.1846C>T
              9.

              rs386374947 [Homo sapiens]
                AAAAAAAAAAAAAAAAAAAAAAAAA[-/AAA]AAGCAATGCTTTCTCTAAAATCAAA
                Chromosome:
                11:113277874
                Gene:
                LOC105369499 (GeneView) NCAM1 (GeneView)
                Functional Consequence:
                downstream variant 500B,utr variant 3 prime
                Validated:
                no info
                HGVS:
                CM000673.2:g.113277874_113277875insAAA, NC_000011.10:g.113277874_113277875insAAA, NC_000011.9:g.113148596_113148597insAAA, NG_032036.1:g.321628_321629insAAA, NM_000615.6:c.*2487_*2488insAAA, NM_001242607.1:c.*2487_*2488insAAA, NM_181351.4:c.*2487_*2488insAAA, NW_003871078.1:g.460600_460601insAAA, XR_001748388.1:n.1333_1334insTTT
                10.
                11.

                rs201796555 [Homo sapiens]
                  TCCCACTCAAGCCAACGGCAGCCCC[A/C]CCTCAGGCCTGAGCACCGGGGCCAT
                  Chromosome:
                  11:113270202
                  Gene:
                  NCAM1-AS1 (GeneView) NCAM1 (GeneView)
                  Functional Consequence:
                  missense,splice donor variant
                  Validated:
                  by cluster,by frequency
                  HGVS:
                  CM000673.2:g.113270202A>C, NC_000011.10:g.113270202A>C, NC_000011.9:g.113140924A>C, NG_032036.1:g.313956A>C, NM_000615.6:c.2116A>C, NM_001242607.1:c.2224A>C, NM_181351.4:c.2146A>C, NP_000606.3:p.Thr706Pro, NP_001229536.1:p.Thr742Pro, NP_851996.2:p.Thr716Pro, NR_034101.1:n.596+2T>G, NW_003871078.1:g.452928A>C
                  13.

                  rs201646237 [Homo sapiens]
                    CCCACTCAAGCCAACGGCAGCCCCA[C/G]CTCAGGCCTGAGCACCGGGGCCATC
                    Chromosome:
                    11:113270203
                    Gene:
                    NCAM1-AS1 (GeneView) NCAM1 (GeneView)
                    Functional Consequence:
                    missense,splice donor variant
                    Validated:
                    by cluster
                    HGVS:
                    CM000673.2:g.113270203C>G, NC_000011.10:g.113270203C>G, NC_000011.9:g.113140925C>G, NG_032036.1:g.313957C>G, NM_000615.6:c.2117C>G, NM_001242607.1:c.2225C>G, NM_181351.4:c.2147C>G, NP_000606.3:p.Thr706Ser, NP_001229536.1:p.Thr742Ser, NP_851996.2:p.Thr716Ser, NR_034101.1:n.596+1G>C, NW_003871078.1:g.452929C>G
                    14.

                    rs201206514 [Homo sapiens]
                      GCAGGGGGGGGGGCACAGAATTTAC[C/T]GCGGCAAGACATCCCTCCCAGCCAG
                      Chromosome:
                      11:112961577
                      Gene:
                      LOC101928847 (GeneView) NCAM1 (GeneView)
                      Functional Consequence:
                      intron variant,utr variant 5 prime
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      T=0.0008/4
                      HGVS:
                      CM000673.2:g.112961577C>T, NC_000011.10:g.112961577C>T, NC_000011.9:g.112832299C>T, NG_032036.1:g.5331C>T, NM_000615.6:c.-36C>T, NM_001076682.3:c.-36C>T, NM_001242607.1:c.-36C>T, NM_001242608.1:c.-36C>T, NM_181351.4:c.-36C>T, NR_120563.1:n.252-101G>A, NW_003871078.1:g.144303C>T, XR_246476.1:n.246-101G>A, XR_254422.1:n.246-101G>A
                      16.

                      rs200617376 [Homo sapiens]
                        TGCTTCAGGGAATTAGTGTCTTTTT[C/T]TGGAAATCTGTTGAAGTAAAGTAAC
                        Chromosome:
                        11:113276670
                        Gene:
                        NCAM1 (GeneView)
                        Functional Consequence:
                        utr variant 3 prime
                        Validated:
                        no info
                        HGVS:
                        CM000673.2:g.113276670T>C, NC_000011.10:g.113276670T>C, NC_000011.9:g.113147392T>C, NG_032036.1:g.320424T>C, NM_000615.6:c.*1283T>C, NM_001242607.1:c.*1283T>C, NM_181351.4:c.*1283T>C, NW_003871078.1:g.459396T>C

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center