Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 303

1.

rs781626368 [Homo sapiens]
    TGCAGAAGAGCACCCCAAACTGCAG[C/T]AGCAGCCTGCGGGCACGGCCTGCCA
    Chromosome:
    11:62705429
    Gene:
    BSCL2 (GeneView) GNG3 (GeneView) HNRNPUL2-BSCL2 (GeneView)
    Functional Consequence:
    nc transcript variant,synonymous codon,upstream variant 2KB
    Validated:
    no info
    HGVS:
    NC_000011.10:g.62705429C>T, NC_000011.9:g.62472901C>T, NG_008461.1:g.9146G>A, NM_001122955.3:c.276G>A, NM_001130702.2:c.84G>A, NM_032667.6:c.84G>A, NP_001116427.1:p.Leu92, NP_001124174.2:p.Leu28, NP_116056.3:p.Leu28, NR_037946.1:n.2796G>A, NR_037948.1:n.878G>A, NR_037949.1:n.878G>A, XM_005273909.1:c.276G>A, XM_006718500.2:c.-2136C>T, XP_005273966.1:p.Leu92
    2.

    rs781527096 [Homo sapiens]
      TTGATAGAAGGCCCCTCTCACCTGT[A/G]GTAGAAATGCACAGGGCTGAGGTGG
      Chromosome:
      11:62705305
      Gene:
      BSCL2 (GeneView) GNG3 (GeneView) HNRNPUL2-BSCL2 (GeneView)
      Functional Consequence:
      missense,nc transcript variant,upstream variant 2KB
      Validated:
      no info
      HGVS:
      NC_000011.10:g.62705305A>G, NC_000011.9:g.62472777A>G, NG_008461.1:g.9270T>C, NM_001122955.3:c.400T>C, NM_001130702.2:c.208T>C, NM_032667.6:c.208T>C, NP_001116427.1:p.Tyr134His, NP_001124174.2:p.Tyr70His, NP_116056.3:p.Tyr70His, NR_037946.1:n.2920T>C, NR_037948.1:n.1002T>C, NR_037949.1:n.1002T>C, XM_005273909.1:c.400T>C, XM_006718500.2:c.-2260A>G, XP_005273966.1:p.Tyr134His
      3.
      4.
      5.

      rs781022347 [Homo sapiens]
        GCTCCCCAGCCAACACCTTTACCTG[A/G]CTGATGAGCAGAGATCCTTCGTTGG
        Chromosome:
        11:62691078
        Gene:
        BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView) LRRN4CL (GeneView)
        Functional Consequence:
        missense,nc transcript variant,synonymous codon,upstream variant 2KB
        Validated:
        no info
        HGVS:
        NC_000011.10:g.62691078G>A, NC_000011.9:g.62458550G>A, NG_008461.1:g.23497C>T, NG_033077.1:g.3822C>T, NM_001122955.3:c.1069C>T, NM_001130702.2:c.735C>T, NM_032667.6:c.877C>T, NM_203422.3:c.-1657C>T, NP_001116427.1:p.Pro357Ser, NP_001124174.2:p.Ser245, NP_116056.3:p.Pro293Ser, NR_037946.1:n.3589C>T, NR_037948.1:n.1671C>T, NR_037949.1:n.1671C>T, XM_005273909.1:c.1069C>T, XP_005273966.1:p.Pro357Ser
        6.

        rs780533531 [Homo sapiens]
          TGCGCTTGCTGTGGATCTCAATGAT[C/T]GCTCCAGTGGTCGGCACGTACTGTG
          Chromosome:
          11:62692453
          Gene:
          BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
          Functional Consequence:
          nc transcript variant,synonymous codon
          Validated:
          no info
          HGVS:
          NC_000011.10:g.62692453C>T, NC_000011.9:g.62459925C>T, NG_008461.1:g.22122G>A, NG_033077.1:g.2447G>A, NM_001122955.3:c.786G>A, NM_001130702.2:c.594G>A, NM_032667.6:c.594G>A, NP_001116427.1:p.Ala262, NP_001124174.2:p.Ala198, NP_116056.3:p.Ala198, NR_037946.1:n.3306G>A, NR_037948.1:n.1388G>A, NR_037949.1:n.1388G>A, XM_005273909.1:c.786G>A, XP_005273966.1:p.Ala262
          8.

          rs780093151 [Homo sapiens]
            GGAAGGAGCAGAGTGAGGTGGTGGA[A/G]GAATCACAGTCGGTCCTAAATGAGA
            Chromosome:
            11:62702534
            Gene:
            BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
            Functional Consequence:
            nc transcript variant,synonymous codon
            Clinical significance:
            Uncertain significance
            Validated:
            no info
            HGVS:
            NC_000011.10:g.62702534G>A, NC_000011.9:g.62470006G>A, NG_008461.1:g.12041C>T, NM_001122955.3:c.420C>T, NM_001130702.2:c.228C>T, NM_032667.6:c.228C>T, NP_001116427.1:p.Ser140, NP_001124174.2:p.Ser76, NP_116056.3:p.Ser76, NR_037946.1:n.2940C>T, NR_037948.1:n.1022C>T, NR_037949.1:n.1022C>T, XM_005273909.1:c.420C>T, XP_005273966.1:p.Ser140
            9.

            rs779952369 [Homo sapiens]
              GCAGGTGGGGCGCTGTCGGAGAGCA[C/G]CCCCAGCAGGTTCAGAGCTGCCCAG
              Chromosome:
              11:62690404
              Gene:
              BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView) LRRN4CL (GeneView)
              Functional Consequence:
              missense,nc transcript variant,upstream variant 2KB,utr variant 3 prime
              Validated:
              no info
              HGVS:
              NC_000011.10:g.62690404C>G, NC_000011.9:g.62457876C>G, NG_008461.1:g.24171G>C, NG_033077.1:g.4496G>C, NM_001122955.3:c.1352G>C, NM_001130702.2:c.*154G>C, NM_032667.6:c.1160G>C, NM_203422.3:c.-983G>C, NP_001116427.1:p.Gly451Ala, NP_116056.3:p.Gly387Ala, NR_037946.1:n.3872G>C, NR_037948.1:n.1954G>C, NR_037949.1:n.1960G>C, XM_005273909.1:c.1358G>C, XP_005273966.1:p.Gly453Ala
              10.

              rs779682500 [Homo sapiens]
                ATCTGGTTTCTCCTCCTCGGACAGC[C/T]GACCCTCTGCAGCCAAAAGGGGAAT
                Chromosome:
                11:62690686
                Gene:
                BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView) LRRN4CL (GeneView)
                Functional Consequence:
                missense,nc transcript variant,upstream variant 2KB
                Validated:
                by frequency
                HGVS:
                NC_000011.10:g.62690686T>C, NC_000011.9:g.62458158T>C, NG_008461.1:g.23889A>G, NG_033077.1:g.4214A>G, NM_001122955.3:c.1160A>G, NM_001130702.2:c.826A>G, NM_032667.6:c.968A>G, NM_203422.3:c.-1265A>G, NP_001116427.1:p.Gln387Arg, NP_001124174.2:p.Ser276Gly, NP_116056.3:p.Gln323Arg, NR_037946.1:n.3680A>G, NR_037948.1:n.1762A>G, NR_037949.1:n.1768A>G, XM_005273909.1:c.1166A>G, XP_005273966.1:p.Gln389Arg
                11.
                12.

                rs779199750 [Homo sapiens]
                  AAGGGGGTCCTTGCCCCTTTCGACC[G/T]GCAAAGAGAAGCGGTGTCGGGGCCA
                  Chromosome:
                  11:62691281
                  Gene:
                  BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView) LRRN4CL (GeneView)
                  Functional Consequence:
                  intron variant,missense,nc transcript variant,upstream variant 2KB
                  Validated:
                  no info
                  HGVS:
                  NC_000011.10:g.62691281T>G, NC_000011.9:g.62458753T>G, NG_008461.1:g.23294A>C, NG_033077.1:g.3619A>C, NM_001122955.3:c.1004A>C, NM_001130702.2:c.672-140A>C, NM_032667.6:c.812A>C, NM_203422.3:c.-1860A>C, NP_001116427.1:p.Gln335Pro, NP_116056.3:p.Gln271Pro, NR_037946.1:n.3524A>C, NR_037948.1:n.1606A>C, NR_037949.1:n.1606A>C, XM_005273909.1:c.1004A>C, XP_005273966.1:p.Gln335Pro
                  13.

                  rs779154593 [Homo sapiens]
                    GTGAGGAGTCTGCCCCTTTTCTTCA[
                    -/GGAACTAGAGCAGGTGGGGCGCT
                    GTC
                    ]GGAGAGCACCCCCAGCAGGTTCAGA
                    Chromosome:
                    11:62690370
                    Gene:
                    BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView) LRRN4CL (GeneView)
                    Functional Consequence:
                    frameshift variant,nc transcript variant,upstream variant 2KB,utr variant 3 prime
                    Validated:
                    by frequency
                    HGVS:
                    NC_000011.10:g.62690370_62690395del26, NC_000011.9:g.62457842_62457867del26, NG_008461.1:g.24180_24205del26, NG_033077.1:g.4505_4530del26, NM_001122955.3:c.1361_1386del26, NM_001130702.2:c.*163_*188del26, NM_032667.6:c.1169_1194del26, NM_203422.3:c.-974_-949del26, NP_001116427.1:p.Arg454Leufs, NP_116056.3:p.Arg390Leufs, NR_037946.1:n.3881_3906del26, NR_037948.1:n.1963_1988del26, NR_037949.1:n.1969_1994del26, XM_005273909.1:c.1367_1392del26, XP_005273966.1:p.Arg456Leufs
                    14.

                    rs779114853 [Homo sapiens]
                      AGGAGCAGGAGCAGGCAGGTTGGCC[C/T]CCGTCAGCAAAGCTGCATCTTCCCA
                      Chromosome:
                      11:62690485
                      Gene:
                      BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView) LRRN4CL (GeneView)
                      Functional Consequence:
                      missense,nc transcript variant,upstream variant 2KB,utr variant 3 prime
                      Validated:
                      no info
                      HGVS:
                      NC_000011.10:g.62690485T>C, NC_000011.9:g.62457957T>C, NG_008461.1:g.24090A>G, NG_033077.1:g.4415A>G, NM_001122955.3:c.1271A>G, NM_001130702.2:c.*73A>G, NM_032667.6:c.1079A>G, NM_203422.3:c.-1064A>G, NP_001116427.1:p.Glu424Gly, NP_116056.3:p.Glu360Gly, NR_037946.1:n.3791A>G, NR_037948.1:n.1873A>G, NR_037949.1:n.1879A>G, XM_005273909.1:c.1277A>G, XP_005273966.1:p.Glu426Gly
                      15.
                      16.
                      17.
                      18.
                      19.

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center