Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 4827

3.

rs781707780 [Homo sapiens]
    AACAACAATCAGTATGCAGGGAGGT[A/G]CTGAGGAGTAAAAGGCCTGGGAGAG
    Chromosome:
    2:168922870
    Gene:
    ABCB11 (GeneView)
    Functional Consequence:
    downstream variant 500B,intron variant,utr variant 3 prime
    Validated:
    no info
    HGVS:
    NC_000002.11:g.169779380G>A, NC_000002.12:g.168922870G>A, NG_007374.1:g.113454C>T, NM_003742.2:c.*752C>T, NW_003315909.1:g.109497G>A, XM_005246930.1:c.*752C>T, XM_006712817.3:c.*752C>T, XM_011512077.2:c.*752C>T, XM_011512078.2:c.*706C>T, XM_011512081.2:c.*752C>T, XM_017005165.1:c.3867+1787C>T, XM_017005166.1:c.*752C>T, XM_017005167.1:c.*752C>T
    9.

    rs781534836 [Homo sapiens]
      GATGTTTTTATTGTAAAACATCTTA[-/TTTG]TTTGTTTAAATGTTTAACTGTTTAG
      Chromosome:
      2:168919036
      Gene:
      ABCB11 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000002.11:g.169775546_169775547insTTTG, NC_000002.12:g.168919036_168919037insTTTG, NW_003315909.1:g.105663_105664insTTTG, XM_017005165.1:c.3868-3355_3868-3354insCAAA
      11.

      rs781489778 [Homo sapiens]
        TCAGAGATGTTCCTCCTGAGCTGCC[A/G]AGGGGGAAATAACTACACACTGAGC
        Chromosome:
        2:168907859
        Gene:
        G6PC2 (GeneView)
        Functional Consequence:
        missense,utr variant 3 prime
        Validated:
        by cluster,by frequency
        HGVS:
        NC_000002.11:g.169764369G>A, NC_000002.12:g.168907859G>A, NG_011682.1:g.11620G>A, NM_001081686.1:c.*267G>A, NM_021176.2:c.848G>A, NP_066999.1:p.Arg283Gln, NW_003315909.1:g.94486G>A, XM_011511564.2:c.620G>A, XM_011511565.2:c.500G>A, XP_011509866.1:p.Arg207Gln, XP_011509867.1:p.Arg167Gln
        13.

        rs781463613 [Homo sapiens]
          CCTGAGCTGCCGAGGGGGAAATAAC[C/T]ACACACTGAGCTTCCGGTTGCTCTG
          Chromosome:
          2:168907873
          Gene:
          G6PC2 (GeneView)
          Functional Consequence:
          missense,utr variant 3 prime
          Validated:
          no info
          HGVS:
          NC_000002.11:g.169764383T>C, NC_000002.12:g.168907873T>C, NG_011682.1:g.11634T>C, NM_001081686.1:c.*281T>C, NM_021176.2:c.862T>C, NP_066999.1:p.Tyr288His, NW_003315909.1:g.94500T>C, XM_011511564.2:c.634T>C, XM_011511565.2:c.514T>C, XP_011509866.1:p.Tyr212His, XP_011509867.1:p.Tyr172His
          15.

          rs781373483 [Homo sapiens]
            TGACACCACGCCTTTTGCTGGACTC[G/T]TGAGAAACCTTGGGGTCCTCTTTGG
            Chromosome:
            2:168907789
            Gene:
            G6PC2 (GeneView)
            Functional Consequence:
            missense,utr variant 3 prime
            Validated:
            no info
            HGVS:
            NC_000002.11:g.169764299G>T, NC_000002.12:g.168907789G>T, NG_011682.1:g.11550G>T, NM_001081686.1:c.*197G>T, NM_021176.2:c.778G>T, NP_066999.1:p.Val260Leu, NW_003315909.1:g.94416G>T, XM_011511564.2:c.550G>T, XM_011511565.2:c.430G>T, XP_011509866.1:p.Val184Leu, XP_011509867.1:p.Val144Leu
            19.

            rs781242281 [Homo sapiens]
              TACCTTTAGCTGTGTCCTTTGAAAG[C/T]TTTAGTTTCATTATGTTTAAGGGTA
              Chromosome:
              2:168906820
              Gene:
              G6PC2 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              HGVS:
              NC_000002.11:g.169763330C>T, NC_000002.12:g.168906820C>T, NG_011682.1:g.10581C>T, NM_001081686.1:c.441-748C>T, NM_021176.2:c.556+41C>T, NW_003315909.1:g.93447C>T, XM_011511564.2:c.329-748C>T, XM_011511565.2:c.208+41C>T

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Support Center