Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 1762

1.

rs781208673 [Homo sapiens]
    CCCTTTGATTTTGAAATCAAAGCCT[A/G]TTTCTCCTCAATTCTTTGACAGTGG
    Chromosome:
    12:58953200
    Gene:
    LOC105369791 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    HGVS:
    NC_000012.11:g.59346981A>G, NC_000012.12:g.58953200A>G, NW_003315941.1:g.23948A>G, XR_001749167.1:n.232-12651A>G, XR_001749168.1:n.226+31728A>G
    2.

    rs781205453 [Homo sapiens]
      GATTCCAACCAACATGAAAGACATT[A/C]TTTATACATTCTACAAAAATAAGGA
      Chromosome:
      12:59054148
      Gene:
      LOC105369791 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by cluster,by frequency
      HGVS:
      NC_000012.11:g.59447929C>A, NC_000012.12:g.59054148C>A, NG_021691.1:g.137G>T, NW_003315941.1:g.131933C>A, XR_001749167.1:n.314-1858C>A, XR_001749168.1:n.227-1858C>A
      3.

      rs781109305 [Homo sapiens]
        CTTCTACAAGTATTGGACTAAAAAC[A/G]TATCTCCAGAAATATAACACCTACC
        Chromosome:
        12:58959101
        Gene:
        LOC105369791 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        HGVS:
        NC_000012.11:g.59352882A>G, NC_000012.12:g.58959101A>G, NW_003315941.1:g.29850A>G, XR_001749167.1:n.232-6750A>G, XR_001749168.1:n.226+37629A>G
        4.

        rs780897611 [Homo sapiens]
          GGCATTGCCTTGGGAGAAAAACACA[C/T]ATAGTCTTCAAGGTGAAACTTAAAA
          Chromosome:
          12:58942137
          Gene:
          LOC105369791 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by frequency
          HGVS:
          NC_000012.11:g.59335918T>C, NC_000012.12:g.58942137T>C, NW_003315941.1:g.12879T>C, XR_001749167.1:n.231+20665T>C, XR_001749168.1:n.226+20665T>C
          5.

          rs780888026 [Homo sapiens]
            GTTCTTATTTCTCTATTTCCTTGAG[-/GT]GTGACCTTAGAGTGTCAGTTTGTGC
            Chromosome:
            12:58947534
            Gene:
            LOC105369791 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by cluster
            HGVS:
            NC_000012.11:g.59341315_59341316delGT, NC_000012.12:g.58947534_58947535delGT, NW_003315941.1:g.18278_18279delGT, XR_001749167.1:n.232-18317_232-18316delGT, XR_001749168.1:n.226+26062_226+26063delGT
            6.

            rs780846579 [Homo sapiens]
              AGCACAGAAATATCAGATATCCACA[A/T]AGCAGCAGGCCACATCATTCACTTG
              Chromosome:
              12:58930956
              Gene:
              LOC105369791 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              HGVS:
              NC_000012.11:g.59324737T>A, NC_000012.12:g.58930956T>A, NW_003315941.1:g.1692T>A, XR_001749167.1:n.231+9484T>A, XR_001749168.1:n.226+9484T>A
              7.

              rs780839014 [Homo sapiens]
                GAGTTTTCCAGTTGTTCTTTGTGCT[G/T]CTGGTATTTGGATGTCTAGGTCTCT
                Chromosome:
                12:58949267
                Gene:
                LOC105369791 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                no info
                HGVS:
                NC_000012.11:g.59343048T>G, NC_000012.12:g.58949267T>G, NW_003315941.1:g.20015T>G, XR_001749167.1:n.232-16584T>G, XR_001749168.1:n.226+27795T>G
                8.

                rs780838019 [Homo sapiens]
                  TGTATCAATCAGGATTTTTTTTTTC[A/G]GTTGCTGATGTCAAAGCCCAATTCC
                  Chromosome:
                  12:59059501
                  Gene:
                  LOC105369791 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  no info
                  HGVS:
                  NC_000012.11:g.59453282A>G, NC_000012.12:g.59059501A>G, NW_003315941.1:g.137286A>G, XR_001749167.1:n.416+3393A>G, XR_001749168.1:n.329+3393A>G
                  9.

                  rs780835449 [Homo sapiens]
                    ACTTTACATAATTAGCAACAATTGC[A/G]CTATTAAAAAATAACTGTTAGGTTT
                    Chromosome:
                    12:58941425
                    Gene:
                    LOC105369791 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    HGVS:
                    NC_000012.11:g.59335206G>A, NC_000012.12:g.58941425G>A, NW_003315941.1:g.12167G>A, XR_001749167.1:n.231+19953G>A, XR_001749168.1:n.226+19953G>A
                    10.

                    rs780716540 [Homo sapiens]
                      ACCTTTACTTTAAGGTTATGTGAGT[A/C]CTTATATGTTAGGTGAGTCTCCTGA
                      Chromosome:
                      12:58948633
                      Gene:
                      LOC105369791 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      HGVS:
                      NC_000012.11:g.59342414C>A, NC_000012.12:g.58948633C>A, NW_003315941.1:g.19381C>A, XR_001749167.1:n.232-17218C>A, XR_001749168.1:n.226+27161C>A
                      11.

                      rs780713426 [Homo sapiens]
                        TTAGGTCAGAGAATCTTTAAAATAT[A/C]TTTCATCTTTTATCCTCCTTAATTA
                        Chromosome:
                        12:58930104
                        Gene:
                        LOC105369791 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        NC_000012.11:g.59323885C>A, NC_000012.12:g.58930104C>A, NW_003315941.1:g.840C>A, XR_001749167.1:n.231+8632C>A, XR_001749168.1:n.226+8632C>A
                        12.

                        rs780612359 [Homo sapiens]
                          ATAAAATTACTTCAATCTATGTGTA[C/T]AAGGTGTATATAAAATGTACATAAA
                          Chromosome:
                          12:58937558
                          Gene:
                          LOC105369791 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          no info
                          HGVS:
                          NC_000012.11:g.59331339T>C, NC_000012.12:g.58937558T>C, NW_003315941.1:g.8294T>C, XR_001749167.1:n.231+16086T>C, XR_001749168.1:n.226+16086T>C
                          13.

                          rs780288755 [Homo sapiens]
                            CTCCCCAGTTGATTTTGCTGCTCAG[C/T]CAGGTTTGAGGACTGCTGTTAAAGT
                            Chromosome:
                            12:58957341
                            Gene:
                            LOC105369791 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by frequency
                            HGVS:
                            NC_000012.11:g.59351122C>T, NC_000012.12:g.58957341C>T, NW_003315941.1:g.28089C>T, XR_001749167.1:n.232-8510C>T, XR_001749168.1:n.226+35869C>T
                            14.

                            rs780218946 [Homo sapiens]
                              GTATAATAGTATCTATTTCAGACAG[-/T]TTTTTTGTGAGACTTAGTGTTTTTA
                              Chromosome:
                              12:58941314
                              Gene:
                              LOC105369791 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              no info
                              HGVS:
                              NC_000012.11:g.59335095_59335096insT, NC_000012.12:g.58941314_58941315insT, NW_003315941.1:g.12056_12057insT, XR_001749167.1:n.231+19842_231+19843insT, XR_001749168.1:n.226+19842_226+19843insT
                              15.

                              rs780050536 [Homo sapiens]
                                GCCAAAATGGTTGGGACCACTGCCC[G/T]AGACACTTGACTAAGAACTTCTTCC
                                Chromosome:
                                12:58943779
                                Gene:
                                LOC105369791 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by frequency
                                HGVS:
                                NC_000012.11:g.59337560T>G, NC_000012.12:g.58943779T>G, NW_003315941.1:g.14521T>G, XR_001749167.1:n.232-22072T>G, XR_001749168.1:n.226+22307T>G
                                16.

                                rs779776806 [Homo sapiens]
                                  CTTTAACATTTGCACGGTTGCATAT[A/G]CCATGTCTGGAGTGATGTATAAGTA
                                  Chromosome:
                                  12:58953880
                                  Gene:
                                  LOC105369791 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by cluster
                                  HGVS:
                                  NC_000012.11:g.59347661A>G, NC_000012.12:g.58953880A>G, NW_003315941.1:g.24628A>G, XR_001749167.1:n.232-11971A>G, XR_001749168.1:n.226+32408A>G
                                  17.

                                  rs779766038 [Homo sapiens]
                                    AGAACAGAAATTAGGCCAAAGATTG[C/T]AGAGCATGTGCAGATGCTTAAAAGG
                                    Chromosome:
                                    12:58956189
                                    Gene:
                                    LOC105369791 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000012.11:g.59349970C>T, NC_000012.12:g.58956189C>T, NW_003315941.1:g.26937C>T, XR_001749167.1:n.232-9662C>T, XR_001749168.1:n.226+34717C>T
                                    18.

                                    rs779763980 [Homo sapiens]
                                      TATGTGTCAATTGAATTAAACATGA[C/T]GGGGGATTCCCAGGGTGGAAATTTG
                                      Chromosome:
                                      12:58954091
                                      Gene:
                                      LOC105369791 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000012.11:g.59347872C>T, NC_000012.12:g.58954091C>T, NW_003315941.1:g.24839C>T, XR_001749167.1:n.232-11760C>T, XR_001749168.1:n.226+32619C>T
                                      19.

                                      rs779705065 [Homo sapiens]
                                        TCAACCAAGAGTTCTCTTCCTCTCT[A/C]TATATACATGCAAACTTAAATTTAT
                                        Chromosome:
                                        12:58952997
                                        Gene:
                                        LOC105369791 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000012.11:g.59346778C>A, NC_000012.12:g.58952997C>A, NW_003315941.1:g.23745C>A, XR_001749167.1:n.232-12854C>A, XR_001749168.1:n.226+31525C>A
                                        20.

                                        rs779635562 [Homo sapiens]
                                          GCCCTGGGTTCAAATCCTAAGTGAT[C/T]TTTGGCAATGTTTTGAGAGTTTCTA
                                          Chromosome:
                                          12:58941237
                                          Gene:
                                          LOC105369791 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          by frequency
                                          HGVS:
                                          NC_000012.11:g.59335018C>T, NC_000012.12:g.58941237C>T, NW_003315941.1:g.11979C>T, XR_001749167.1:n.231+19765C>T, XR_001749168.1:n.226+19765C>T

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Support Center