Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 3453

1.

rs781681261 [Homo sapiens]
    AGGGACCACAGAGGAAGGAGGCAAA[A/G]TGGGTTCAGGTGGAGTCAGGCTTAC
    Chromosome:
    15:28523917
    Gene:
    GOLGA8G (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by frequency
    HGVS:
    NC_000015.10:g.28523917A>G, NC_000015.9:g.28769063A>G, NR_033353.1:n.1780+26T>C, NT_187660.1:g.799712A>G, NW_003315943.1:g.223497A>G, NW_011332701.1:g.685926A>G
    2.

    rs781608987 [Homo sapiens]
      AACAAATTACAACTATATGCAAAAA[A/G]ATTAACAAATCTTATAAACTAAATA
      Chromosome:
      15:28479980
      Validated:
      no info
      HGVS:
      NC_000015.9:g.28725126G>A, NT_187660.1:g.755780G>A, NW_003315943.1:g.179560G>A, NW_011332701.1:g.641994G>A
      3.

      rs781484089 [Homo sapiens]
        TGAGGGGCAAAAGGAGAGGCTTCGG[
        -/GAGCAGGAGGAGAGGCTTCAGGA
        GCAGCAGGAGAGGCTTCCA
        ]GAGCAGGAGGAGAGGCTTCAGCAGC
        Chromosome:
        15:28385283
        Gene:
        GOLGA8F (GeneView)
        Functional Consequence:
        nc transcript variant
        Validated:
        by frequency
        HGVS:
        NC_000015.10:g.28385283_28385324del42, NC_000015.9:g.28630429_28630470del42, NR_033351.1:n.1433_1474del42, NT_187660.1:g.632464_632505del42, NW_003315943.1:g.73208_73249del42, NW_011332701.1:g.518678_518719del42
        4.

        rs781402965 [Homo sapiens]
          TCCTGTGGGATGCTAGGAATGGGCC[A/G]AGGTGCCTCCTCCCCCTCACTGTCC
          Chromosome:
          15:28523990
          Gene:
          GOLGA8G (GeneView)
          Functional Consequence:
          nc transcript variant
          Validated:
          no info
          HGVS:
          NC_000015.10:g.28523990G>A, NC_000015.9:g.28769136G>A, NR_033353.1:n.1733C>T, NT_187660.1:g.799785G>A, NW_003315943.1:g.223570G>A, NW_011332701.1:g.685999G>A
          5.

          rs781391413 [Homo sapiens]
            CTGGTCCTGTGAGCCTAGGGTGGGG[A/C]CCAGAAATCTCTATGGGGTGGTGCA
            Chromosome:
            15:28568208
            Validated:
            no info
            HGVS:
            NC_000015.9:g.28813354C>A, NT_187660.1:g.843999C>A, NW_003315943.1:g.267788C>A, NW_011332701.1:g.730213C>A
            7.

            rs781260808 [Homo sapiens]
              ACACACACACACACACACACACACA[-/CAC]AATGACAGGAGTTTTTAAAGATATT
              Chromosome:
              15:28450983
              Validated:
              by cluster
              HGVS:
              NC_000015.9:g.28696129_28696131delCAC, NT_187660.1:g.726782_726784delCAC, NW_003315943.1:g.150564_150566delCAC, NW_011332701.1:g.612996_612998delCAC
              8.

              rs781225773 [Homo sapiens]
                GGGTGGATCACGAGGTCAGGAGATC[C/G]AGACCATCCTGGTTAACACAGTGAA
                Chromosome:
                15:28498217
                Validated:
                by cluster
                HGVS:
                NC_000015.9:g.28743363G>C, NT_187660.1:g.774014G>C, NW_003315943.1:g.197797G>C, NW_011332701.1:g.660228G>C
                9.

                rs781201430 [Homo sapiens]
                  GCCTCTGGATTCCAAAAAAAAAAAA[-/AG]AAAAGAAAAGAAAAGAAAAAACCCT
                  Chromosome:
                  15:28526562
                  Gene:
                  GOLGA8G (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by frequency
                  HGVS:
                  NC_000015.10:g.28526562_28526563delAG, NC_000015.9:g.28771708_28771709delAG, NR_033353.1:n.1275-52_1275-51delCT, NT_187660.1:g.802357_802358delAG, NW_003315943.1:g.226142_226143delAG, NW_011332701.1:g.688571_688572delAG
                  10.

                  rs781157123 [Homo sapiens]
                    GACTCCCAATCCAAAAAAAAAAAAA[-/AG]AAAAGAAAAGAAAAGAAAAACCGAC
                    Chromosome:
                    15:28488116
                    Validated:
                    no info
                    HGVS:
                    NC_000015.9:g.28733262_28733263delAG, NT_187660.1:g.763913_763914delAG, NW_003315943.1:g.187696_187697delAG, NW_011332701.1:g.650127_650128delAG
                    11.

                    rs781128859 [Homo sapiens]
                      TTGTCTGAGGACCCCTCTGGCCACC[A/C]CCCCCACCCCCAGGAGATGGAGGAG
                      Chromosome:
                      15:28387588
                      Gene:
                      GOLGA8F (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by frequency
                      HGVS:
                      NC_000015.10:g.28387588A>C, NC_000015.9:g.28632734A>C, NR_033351.1:n.1677-14A>C, NT_187660.1:g.634769A>C, NW_003315943.1:g.75513A>C, NW_011332701.1:g.520983A>C
                      12.

                      rs781060665 [Homo sapiens]
                        CTCTCTCTCTCTCTCTCTATGTGTG[-/TATA]TATATATATATATATATATATATAT
                        Chromosome:
                        15:28440163
                        Validated:
                        no info
                        HGVS:
                        NT_187660.1:g.715791_715794delTATA, NW_003315943.1:g.139451_139454delTATA, NW_011332701.1:g.602005_602008delTATA
                        13.

                        rs781039154 [Homo sapiens]
                          CATCTGGACAGTGAGGGGGAGGAGG[C/T]ACCTCGGCCCATTCCTAGCATCCCA
                          Chromosome:
                          15:28387641
                          Gene:
                          GOLGA8F (GeneView)
                          Functional Consequence:
                          nc transcript variant
                          Validated:
                          no info
                          HGVS:
                          NC_000015.10:g.28387641C>T, NC_000015.9:g.28632787C>T, NR_033351.1:n.1716C>T, NT_187660.1:g.634822C>T, NW_003315943.1:g.75566C>T, NW_011332701.1:g.521036C>T
                          14.

                          rs781036359 [Homo sapiens]
                            AGCTGTTTTGCCCTCTTCTTCCCCA[-/CCC]CCCCCCCCGTCTCTTTCCTGGAAGT
                            Chromosome:
                            15:28399627
                            Validated:
                            by cluster
                            HGVS:
                            NC_000015.9:g.28644773_28644775delCCC, NT_187660.1:g.646771_646773delCCC, NW_003315943.1:g.87527_87529delCCC, NW_011332701.1:g.532985_532987delCCC
                            15.

                            rs780946061 [Homo sapiens]
                              GGCAGCCCCTCGCCAACATCCCCAC[A/C]CCTACCTCTCCAGCCCCCCCGCATT
                              Chromosome:
                              15:28345328
                              Validated:
                              no info
                              HGVS:
                              NC_000015.9:g.28590474C>A, NT_187660.1:g.592543C>A, NW_003315943.1:g.33287C>A, NW_011332701.1:g.478757C>A
                              16.

                              rs780933053 [Homo sapiens]
                                GGAGACTTATGCGCTGATTGTACTC[C/T]ACCTGGGCCTGGAGCTCTCCTGCCA
                                Chromosome:
                                15:28526408
                                Gene:
                                GOLGA8G (GeneView)
                                Functional Consequence:
                                nc transcript variant
                                Validated:
                                by frequency
                                HGVS:
                                NC_000015.10:g.28526408C>T, NC_000015.9:g.28771554C>T, NR_033353.1:n.1378G>A, NT_187660.1:g.802203C>T, NW_003315943.1:g.225988C>T, NW_011332701.1:g.688417C>T
                                17.

                                rs780921864 [Homo sapiens]
                                  CCCCAGAGGCTGGTGCCCACCCACC[C/T]CCCAGACCTTCTTGGATGGGGTGGA
                                  Chromosome:
                                  15:28525875
                                  Gene:
                                  GOLGA8G (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000015.10:g.28525875T>C, NC_000015.9:g.28771021T>C, NR_033353.1:n.1612+32A>G, NT_187660.1:g.801670T>C, NW_003315943.1:g.225455T>C, NW_011332701.1:g.687884T>C
                                  18.

                                  rs780819063 [Homo sapiens]
                                    TATCCAGTCTACCATTGATGGGCAT[A/T]TATGTTGATTCCATGCCTTTGCTAC
                                    Chromosome:
                                    15:28491302
                                    Gene:
                                    MIR4509-3 (GeneView)
                                    Functional Consequence:
                                    upstream variant 2KB
                                    Validated:
                                    by cluster
                                    HGVS:
                                    NC_000015.10:g.28491302T>A, NC_000015.9:g.28736448T>A, NR_039734.1:n.-457A>T, NT_187660.1:g.767099T>A, NW_003315943.1:g.190882T>A, NW_011332701.1:g.653313T>A
                                    19.

                                    rs780761875 [Homo sapiens]
                                      CCCTGGAGGGTGCTGGGGTCACCTG[C/T]CCCCGGGCTGGAGCTACCGCTGGCC
                                      Chromosome:
                                      15:28525811
                                      Gene:
                                      GOLGA8G (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000015.10:g.28525811C>T, NC_000015.9:g.28770957C>T, NR_033353.1:n.1612+96G>A, NT_187660.1:g.801606C>T, NW_003315943.1:g.225391C>T, NW_011332701.1:g.687820C>T
                                      20.

                                      rs780561295 [Homo sapiens]
                                        AGCAGGGAGGCCATGGTGAGCCTGA[A/C]TCCACCTGAACCCATTTTGCCTCCT
                                        Chromosome:
                                        15:28387704
                                        Gene:
                                        GOLGA8F (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by frequency
                                        HGVS:
                                        NC_000015.10:g.28387704C>A, NC_000015.9:g.28632850C>A, NR_033351.1:n.1768+11C>A, NT_187660.1:g.634885C>A, NW_003315943.1:g.75629C>A, NW_011332701.1:g.521099C>A

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Support Center