Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 10751

1.

rs781778039 [Homo sapiens]
    TCAAAATAGGGTTGGACATAGCTGG[A/G/T]ATTTAAATGTTTCTTAATGTTAGTT
    Chromosome:
    17:70451233
    Validated:
    no info
    HGVS:
    NC_000017.10:g.68447374G>A, NC_000017.11:g.70451233G>A, NC_000017.11:g.70451233G>T, NW_003315954.1:g.151009G>A, NW_003315954.1:g.151009G>T
    2.

    rs781757213 [Homo sapiens]
      GTATATTTGTCAAAACCCACAGAAT[A/G]CACAGCACCAAGGGTAACCCTAACG
      Chromosome:
      17:70452730
      Validated:
      no info
      HGVS:
      NC_000017.10:g.68448871G>A, NW_003315954.1:g.152506G>A
      3.

      rs781756425 [Homo sapiens]
        GTCTCACTCACTCTGTCATCCATGA[C/T]GGAGTGCAGTGATTTGACCTTGGCT
        Chromosome:
        17:70370050
        Validated:
        by cluster
        HGVS:
        NC_000017.10:g.68366191T>C, NW_003315954.1:g.69826T>C
        4.

        rs781753563 [Homo sapiens]
          AAATAACAAATGTCTCCCTCACCTC[A/C/T]TTAATGTTTCTATTGCTTAGTTCCA
          Chromosome:
          17:70470176
          Validated:
          no info
          HGVS:
          NC_000017.10:g.68466317C>A, NC_000017.10:g.68466317C>T, NC_000017.11:g.70470176C>A, NC_000017.11:g.70470176C>T, NW_003315954.1:g.169952C>A, NW_003315954.1:g.169952C>T
          5.

          rs781753496 [Homo sapiens]
            GAAACTCAAAATAGTAATATTGCTG[A/T]TCAGCAACTAATTACTCTGAAGCTT
            Chromosome:
            17:70499472
            Validated:
            no info
            HGVS:
            NC_000017.10:g.68495613A>T, NW_003315954.1:g.199248A>T
            6.

            rs781728726 [Homo sapiens]
              TGTACTAACACATCTTCATTCTGTT[A/G]GGTTAACTCGTGCTTTTGTGAGTCA
              Chromosome:
              17:70404593
              Validated:
              by frequency
              HGVS:
              NC_000017.10:g.68400734A>G, NW_003315954.1:g.104369A>G
              7.

              rs781687101 [Homo sapiens]
                ATGGCTTAAGCCCAGGAGTTTGAGA[A/C]CAGCCTGGACAACACAGGGAGACTT
                Chromosome:
                17:70335802
                Validated:
                no info
                HGVS:
                NC_000017.10:g.68331943C>A, NW_003315954.1:g.29525C>A
                8.

                rs781659789 [Homo sapiens]
                  GATTCAGCGATCCCACGACTAGGTG[C/T]GTATCCAGAGGAAAAGAAATCAGTC
                  Chromosome:
                  17:70385892
                  Validated:
                  no info
                  HGVS:
                  NC_000017.10:g.68382033C>T, NW_003315954.1:g.85668C>T
                  9.

                  rs781602739 [Homo sapiens]
                    CTCATATGAAGATAATAGAAGCTGG[A/G]CAAAATGTTCTCAGTAGACTAGGAA
                    Chromosome:
                    17:70437571
                    Validated:
                    no info
                    HGVS:
                    NC_000017.10:g.68433712G>A, NW_003315954.1:g.137347G>A
                    10.

                    rs781582626 [Homo sapiens]
                      TGGTTAAAGGATCTTTTAGTGGACA[C/G]TATGTATTTAACAAGAGGAAAGATG
                      Chromosome:
                      17:70360873
                      Validated:
                      no info
                      HGVS:
                      NC_000017.10:g.68357014C>G, NW_003315954.1:g.54596C>G
                      11.

                      rs781562115 [Homo sapiens]
                        ACTCAGTTAGGGGTGTGACTCTCCA[C/G]GCATATACATGTAATAATTGGCAGA
                        Chromosome:
                        17:70439028
                        Validated:
                        no info
                        HGVS:
                        NC_000017.10:g.68435169G>C, NW_003315954.1:g.138804G>C
                        12.

                        rs781527132 [Homo sapiens]
                          ACCTATATCTTAAGAAATAAAAAGC[-/T]TACTAATGAAACTTTAAAAATATTT
                          Chromosome:
                          17:70511860
                          Validated:
                          by cluster
                          HGVS:
                          NC_000017.10:g.68508001delT, NW_003315954.1:g.211636delT
                          13.

                          rs781499382 [Homo sapiens]
                            TAACTGAAAGTACAATGACTGCCTA[C/T]GGTGTACACTTAAACTGAAGGTACA
                            Chromosome:
                            17:70367832
                            Validated:
                            by frequency
                            HGVS:
                            NC_000017.10:g.68363973C>T, NW_003315954.1:g.67608C>T
                            14.

                            rs781496376 [Homo sapiens]
                              ATATTACTCAGCGAAAAGGGCCGGG[C/T]GCGGTGGCTCACGCCTGTAATCCTA
                              Chromosome:
                              17:70416960
                              Validated:
                              by cluster
                              HGVS:
                              NC_000017.10:g.68413101C>T, NW_003315954.1:g.116736C>T
                              15.

                              rs781495100 [Homo sapiens]
                                CAACATGGAGGAGGCTGGAGGACAT[A/T]ACGTTATTCGAGAAATAGGCCAACA
                                Chromosome:
                                17:70494125
                                Validated:
                                no info
                                HGVS:
                                NC_000017.10:g.68490266T>A, NW_003315954.1:g.193901T>A
                                16.

                                rs781486747 [Homo sapiens]
                                  GAAGTAGACAGAAAACTTGCAGAAG[A/G]CTTAATACTGAATATTTGAGGCAAG
                                  Chromosome:
                                  17:70500185
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000017.10:g.68496326A>G, NW_003315954.1:g.199961A>G
                                  17.

                                  rs781468681 [Homo sapiens]
                                    TTTCCTTAATGCTTTTATCACAGCC[-/T]TTTTTGGACTACATACTATTTTGCA
                                    Chromosome:
                                    17:70515628
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000017.10:g.68511769_68511770insT, NW_003315954.1:g.215404_215405insT
                                    18.

                                    rs781462573 [Homo sapiens]
                                      AGTTGCCATGTATGTATGGGTGCAC[
                                      -/AAGTGTGTGTGT
                                      ]GTGTGTGTGTGTGTGTGTGTGTGTG
                                      Chromosome:
                                      17:70327112
                                      Validated:
                                      by cluster
                                      HGVS:
                                      NC_000017.10:g.68323253_68323264delAAGTGTGTGTGT, NW_003315954.1:g.20835_20846delAAGTGTGTGTGT
                                      19.

                                      rs781459487 [Homo sapiens]
                                        GAGAAATGTATCTACTAAAGGTGAA[A/G]TACTTTAGACTTGGACAAACCAGAG
                                        Chromosome:
                                        17:70477390
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000017.10:g.68473531A>G, NW_003315954.1:g.177166A>G
                                        20.

                                        rs781440027 [Homo sapiens]
                                          ACAGATGCTTCTTAATATTTGCCGA[G/T]TTATTGCTGAAACAAGTGCAGCAGA
                                          Chromosome:
                                          17:70439371
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000017.10:g.68435512T>G, NW_003315954.1:g.139147T>G

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Support Center