Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 2744

1.

rs781640549 [Homo sapiens]
    GGTGGTTCAACCCTGTGATCCCAGC[A/G]CTTTGGGAGGCTGAGGTGGTCGGAT
    Chromosome:
    17:77244845
    Validated:
    by cluster
    HGVS:
    NC_000017.10:g.75240927A>G, NW_003315955.1:g.35736A>G
    2.

    rs781609716 [Homo sapiens]
      GCTTGAGCCCAGAAGTTCGAGACCA[G/T]CCTGGCCCACATGGTGAAACTCTGT
      Chromosome:
      17:77222698
      Validated:
      by frequency
      HGVS:
      NC_000017.10:g.75218780G>T, NW_003315955.1:g.13586G>T
      3.

      rs781437348 [Homo sapiens]
        TAGAGACGGGGTTTCCCTACATTGG[A/C]CGGGCTGGTCTCGAACTCTTGACCT
        Chromosome:
        17:77292701
        Gene:
        LOC107984143 (GeneView) SEPT9 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by cluster,by frequency
        HGVS:
        NC_000017.10:g.75288783C>A, NC_000017.11:g.77292701C>A, NG_011683.1:g.16292C>A, NM_001113491.1:c.19+11147C>A, NM_001113492.1:c.-474+4491C>A, NM_001293695.1:c.19+11147C>A, NW_003315955.1:g.83594C>A, XM_005256958.1:c.19+11147C>A, XM_006721643.2:c.-603-2073C>A, XM_011524204.1:c.30-1788C>A, XR_001756490.1:n.119-1788C>A
        4.

        rs781428070 [Homo sapiens]
          TACCACCCTTCCTGAGCTATCCAGC[G/T]ACTAGGCTTCAGGTAGTGTGGTGGA
          Chromosome:
          17:77221094
          Validated:
          no info
          HGVS:
          NC_000017.10:g.75217176G>T, NW_003315955.1:g.11980G>T
          5.

          rs781427479 [Homo sapiens]
            CATGGCAGCAGGAAGGAGAAGTACA[C/G]AATGAAAGTGGGGAAAGCCCCTTAT
            Chromosome:
            17:77225466
            Validated:
            no info
            HGVS:
            NC_000017.10:g.75221548G>C, NW_003315955.1:g.16358G>C
            6.

            rs781368683 [Homo sapiens]
              TCACGAGGTCTGATGGTTTTATAAG[A/G]GGCTCTTCTCCCTTCCTATTCCTTC
              Chromosome:
              17:77230918
              Validated:
              no info
              HGVS:
              NC_000017.10:g.75227000G>A, NW_003315955.1:g.21812G>A
              7.

              rs781285906 [Homo sapiens]
                GTAGTGGGGTTGGATGACGAGCCAC[A/G]CTGGTGAACCGATTTCCTGATCCTC
                Chromosome:
                17:77231206
                Validated:
                no info
                HGVS:
                NC_000017.10:g.75227288G>A, NW_003315955.1:g.22100G>A
                8.

                rs781187880 [Homo sapiens]
                  TGACAGAGTGAGGCTCTGTCTCCAA[
                  -/AAAAAAAAAA
                  ]AAAAAAAAAAGGAAAATAAAATTAA
                  Chromosome:
                  17:77227233
                  Validated:
                  by cluster
                  HGVS:
                  NC_000017.10:g.75223315_75223324delAAAAAAAAAA, NW_003315955.1:g.18127_18136delAAAAAAAAAA
                  9.
                  10.

                  rs781043185 [Homo sapiens]
                    GTCAGATCTCCCCGGCCTGCCCAGA[G/T]GGATTCTGATAGCCGAGGGCAATGC
                    Chromosome:
                    17:77286329
                    Gene:
                    LOC107984143 (GeneView) SEPT9 (GeneView)
                    Functional Consequence:
                    intron variant,upstream variant 2KB
                    Validated:
                    by frequency
                    HGVS:
                    NC_000017.10:g.75282411G>T, NC_000017.11:g.77286329G>T, NG_011683.1:g.9920G>T, NM_001113491.1:c.19+4775G>T, NM_001113492.1:c.-2355G>T, NM_001293695.1:c.19+4775G>T, NW_003315955.1:g.77222G>T, XM_005256958.1:c.19+4775G>T, XM_006721643.2:c.-604+4775G>T, XM_011524204.1:c.-1853G>T, XR_001756490.1:n.118+4775G>T
                    11.

                    rs780914915 [Homo sapiens]
                      ACCCAGGTGAGGCGGGCGCGGGATC[C/T]CGGTTGCCACAGGCATCGGAGCGGC
                      Chromosome:
                      17:77246991
                      Validated:
                      no info
                      HGVS:
                      NC_000017.10:g.75243073C>T, NW_003315955.1:g.37884C>T
                      12.

                      rs780565988 [Homo sapiens]
                        GGCGGCTCCTGGGCACTGCTTGCCA[A/G]TGGCCTCTCGGCAGCTCTGTGACAG
                        Chromosome:
                        17:77287741
                        Gene:
                        LOC107984143 (GeneView) SEPT9 (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Validated:
                        no info
                        HGVS:
                        NC_000017.10:g.75283823A>G, NC_000017.11:g.77287741A>G, NG_011683.1:g.11332A>G, NM_001113491.1:c.19+6187A>G, NM_001113492.1:c.-943A>G, NM_001293695.1:c.19+6187A>G, NW_003315955.1:g.78634A>G, XM_005256958.1:c.19+6187A>G, XM_006721643.2:c.-604+6187A>G, XM_011524204.1:c.-441A>G, XR_001756490.1:n.118+6187A>G
                        13.

                        rs780518840 [Homo sapiens]
                          TGGAGGTTGTAGCGAGCCAAGATTG[C/T]AGCACTGCACTCCAGCCTAGGTGAC
                          Chromosome:
                          17:77235944
                          Validated:
                          by cluster,by frequency
                          HGVS:
                          NC_000017.10:g.75232026C>T, NW_003315955.1:g.26837C>T
                          14.

                          rs780484238 [Homo sapiens]
                            CATGCCTGGCCTGTTTTTGTTTTTG[-/TT]TTTTGTTTTTTTTGAGACGATCTTG
                            Chromosome:
                            17:77221539
                            Validated:
                            by cluster
                            HGVS:
                            NC_000017.10:g.75217621_75217622delTT, NW_003315955.1:g.12425_12426delTT
                            15.

                            rs780406508 [Homo sapiens]
                              GGGTTTTCACCATGTTGGCCAGGCT[A/G]GTCTCGAACTCCTGACCTCAGGTGA
                              Chromosome:
                              17:77232151
                              Validated:
                              no info
                              HGVS:
                              NC_000017.10:g.75228233G>A, NW_003315955.1:g.23045G>A
                              16.

                              rs780351456 [Homo sapiens]
                                GGTTGTCTCCCAAATGGCTTTTCCA[C/G]CTGGGTTTGTTCAAAACAGGATCCC
                                Chromosome:
                                17:77243137
                                Validated:
                                no info
                                HGVS:
                                NC_000017.10:g.75239219G>C, NW_003315955.1:g.34028G>C
                                17.

                                rs780292201 [Homo sapiens]
                                  CCCCATTTTGGGGGGCCCACCTCAC[C/T]TATCAGGGTGCAGCTTCTCCTCTGA
                                  Chromosome:
                                  17:77249647
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000017.10:g.75245729C>T, NW_003315955.1:g.40540C>T
                                  18.
                                  19.
                                  20.

                                  rs780238138 [Homo sapiens]
                                    AGGAGAATCGCTTGAACCCGGGAGG[C/T]GGAGGTTGCAGTGAGGCGAGATTGT
                                    Chromosome:
                                    17:77222267
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000017.10:g.75218349C>T, NW_003315955.1:g.13155C>T

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Support Center