Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 6410

1.

rs781773091 [Homo sapiens]
    ATGCAGGCTTCATAGAATGAGTTAG[A/G]GAGAAGATCCTCTTCCTTGATTTTT
    Chromosome:
    18:67460550
    Validated:
    no info
    HGVS:
    NC_000018.10:g.67460550G>A, NC_000018.9:g.65127787G>A, NW_003315960.1:g.106277G>A
    2.

    rs781692660 [Homo sapiens]
      TAAATTTTAAATTAAATTCTACAAA[C/T]TAAATCTATGCAGATTTAGCTTCTT
      Chromosome:
      18:67507844
      Gene:
      DSEL (GeneView)
      Functional Consequence:
      utr variant 3 prime
      Validated:
      no info
      HGVS:
      NC_000018.10:g.67507844C>T, NC_000018.9:g.65175081C>T, NM_032160.2:c.*3126G>A, NW_003315960.1:g.153571C>T
      3.

      rs781675400 [Homo sapiens]
        AGAGCAGCTTAGCATCTTTTTTGAA[A/T]TTTTTTAAAATTTCCATAGGTTTTT
        Chromosome:
        18:67541422
        Gene:
        LOC643542 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        HGVS:
        NC_000018.10:g.67541422A>T, NC_000018.9:g.65208659A>T, NR_033921.1:n.204+24673A>T, NW_003315960.1:g.187149A>T
        4.

        rs781669920 [Homo sapiens]
          CAGTGTCCTTTACCCAACCACCCCA[A/C]TTACTAGTTAAAATTCTTCTGACTG
          Chromosome:
          18:67518138
          Gene:
          DSEL (GeneView) LOC643542 (GeneView)
          Functional Consequence:
          intron variant,upstream variant 2KB
          Validated:
          no info
          HGVS:
          NC_000018.10:g.67518138C>A, NC_000018.9:g.65185375C>A, NM_032160.2:c.-2632G>T, NR_033921.1:n.204+1389C>A, NW_003315960.1:g.163865C>A
          5.

          rs781654478 [Homo sapiens]
            AGGGCATGTTTTTAAGATTTGTAGA[C/T]GGCAGTAAGCTAGGAGTGATAACTA
            Chromosome:
            18:67482842
            Validated:
            no info
            HGVS:
            NC_000018.10:g.67482842C>T, NC_000018.9:g.65150079C>T, NW_003315960.1:g.128569C>T
            6.

            rs781611726 [Homo sapiens]
              CTTTTGGTTGGGTCTGAAATCTTGC[A/C]CTTTCTGTGTTTTAAACTGATCTAT
              Chromosome:
              18:67514469
              Gene:
              DSEL (GeneView)
              Functional Consequence:
              missense
              Validated:
              no info
              HGVS:
              NC_000018.10:g.67514469A>C, NC_000018.9:g.65181706A>C, NM_032160.2:c.170T>G, NP_115536.1:p.Val57Gly, NW_003315960.1:g.160196A>C
              7.

              rs781558587 [Homo sapiens]
                AATAATGCTAAGAATAGTAAATGTC[C/T]TGTAAACATTAACGCCATGATCCAT
                Chromosome:
                18:67514590
                Gene:
                DSEL (GeneView) LOC643542 (GeneView)
                Functional Consequence:
                missense,upstream variant 2KB
                Validated:
                by frequency
                HGVS:
                NC_000018.10:g.67514590C>T, NC_000018.9:g.65181827C>T, NM_032160.2:c.49G>A, NP_115536.1:p.Gly17Arg, NR_033921.1:n.-1956C>T, NW_003315960.1:g.160317C>T
                8.

                rs781549120 [Homo sapiens]
                  ACCATTATTAATAAGCACACATGCA[C/T]AGCTGAAAAAATGCAAAAATAAAAT
                  Chromosome:
                  18:67466695
                  Validated:
                  no info
                  HGVS:
                  NC_000018.10:g.67466695T>C, NC_000018.9:g.65133932T>C, NW_003315960.1:g.112422T>C
                  9.

                  rs781548828 [Homo sapiens]
                    TACCAGTATCAGAAAGTTCATGGTG[C/G]TATTAAAAATGTCAATTATCAAATC
                    Chromosome:
                    18:67522292
                    Gene:
                    LOC643542 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    HGVS:
                    NC_000018.10:g.67522292C>G, NC_000018.9:g.65189529C>G, NR_033921.1:n.204+5543C>G, NW_003315960.1:g.168019C>G
                    10.

                    rs781524654 [Homo sapiens]
                      AATGGTTACAGTTGTATTAGGTTCC[A/G]GGTTAAGACTCCAAGATACAACAAA
                      Chromosome:
                      18:67489804
                      Validated:
                      no info
                      HGVS:
                      NC_000018.10:g.67489804G>A, NC_000018.9:g.65157041G>A, NW_003315960.1:g.135531G>A
                      11.

                      rs781486842 [Homo sapiens]
                        AACTATATCACAGCTTGCCAGGCCT[A/G]CAGTTTTCTTAGGTCTTGAGTGGGG
                        Chromosome:
                        18:67528578
                        Gene:
                        LOC643542 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        NC_000018.10:g.67528578A>G, NC_000018.9:g.65195815A>G, NR_033921.1:n.204+11829A>G, NW_003315960.1:g.174305A>G
                        12.

                        rs781474359 [Homo sapiens]
                          AAAGTGGGTTGGTAAGTATTATTAG[C/T]GCAAATTTCTGCTGACCTGCAGCAT
                          Chromosome:
                          18:67510944
                          Gene:
                          DSEL (GeneView)
                          Functional Consequence:
                          utr variant 3 prime
                          Validated:
                          no info
                          HGVS:
                          NC_000018.10:g.67510944T>C, NC_000018.9:g.65178181T>C, NM_032160.2:c.*26A>G, NW_003315960.1:g.156671T>C
                          13.

                          rs781471076 [Homo sapiens]
                            AAATGCAAGGTAGATATTAGTATTG[C/T]CATTTTACAGATGAGGAAACTATGG
                            Chromosome:
                            18:67471897
                            Validated:
                            no info
                            HGVS:
                            NC_000018.10:g.67471897C>T, NC_000018.9:g.65139134C>T, NW_003315960.1:g.117625C>T
                            14.

                            rs781467675 [Homo sapiens]
                              ACAAAGGCCAGTAAAATCCTCCGGT[A/G]TGCCCTTTCCCAGAGATCTAAAGTC
                              Chromosome:
                              18:67484672
                              Validated:
                              no info
                              HGVS:
                              NC_000018.10:g.67484672A>G, NC_000018.9:g.65151909A>G, NW_003315960.1:g.130399A>G
                              15.

                              rs781427599 [Homo sapiens]
                                TCTCCTGGTGCATTCTCTACTAGCC[A/C]GTCTTTGTAGCCAACCATCCTGTCC
                                Chromosome:
                                18:67514137
                                Gene:
                                DSEL (GeneView)
                                Functional Consequence:
                                missense
                                Validated:
                                no info
                                HGVS:
                                NC_000018.10:g.67514137A>C, NC_000018.9:g.65181374A>C, NM_032160.2:c.502T>G, NP_115536.1:p.Trp168Gly, NW_003315960.1:g.159864A>C
                                16.

                                rs781362507 [Homo sapiens]
                                  ATCATGAGACTAAAAGGACATACTT[-/A]ACACTAAATGACCTCTAGTTCCCTT
                                  Chromosome:
                                  18:67456706
                                  Validated:
                                  by cluster
                                  HGVS:
                                  NC_000018.10:g.67456706_67456707insA, NC_000018.9:g.65123943_65123944insA, NW_003315960.1:g.102433_102434insA
                                  17.

                                  rs781348655 [Homo sapiens]
                                    CAGAGCCTACCAAAATAAAATAAAC[C/G]ACACTTTATGACGACTACATTTATA
                                    Chromosome:
                                    18:67509820
                                    Gene:
                                    DSEL (GeneView)
                                    Functional Consequence:
                                    utr variant 3 prime
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000018.10:g.67509820C>G, NC_000018.9:g.65177057C>G, NM_032160.2:c.*1150G>C, NW_003315960.1:g.155547C>G
                                    18.

                                    rs781339077 [Homo sapiens]
                                      AAAAGTTAGATTAACTTAAAGATTT[G/T]TGTTAGCTAGTTAGATTTTGTTAGC
                                      Chromosome:
                                      18:67427999
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000018.10:g.67427999T>G, NC_000018.9:g.65095236T>G, NW_003315960.1:g.4277T>G
                                      19.

                                      rs781291532 [Homo sapiens]
                                        GAACCAGGAAGTGAGGTAATGACAA[C/T]ATCAGGAAGATCCATGTGGTGCCCT
                                        Chromosome:
                                        18:67512046
                                        Gene:
                                        DSEL (GeneView)
                                        Functional Consequence:
                                        missense
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000018.10:g.67512046C>T, NC_000018.9:g.65179283C>T, NM_032160.2:c.2593G>A, NP_115536.1:p.Val865Ile, NW_003315960.1:g.157773C>T
                                        20.

                                        rs781288480 [Homo sapiens]
                                          ACCAATAATCTTAAATGTCAACAAC[A/G]TCAGATTTCAATTTTGTTCACTGAA
                                          Chromosome:
                                          18:67428980
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000018.10:g.67428980G>A, NC_000018.9:g.65096217G>A, NW_003315960.1:g.5258G>A

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Support Center