Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 699

1.

rs781728817 [Homo sapiens]
    GGTGTGAAGAGGAACTCATCCGGGG[A/G]ATGCGTGTGGGCTCCTGGAAGGCAT
    Chromosome:
    5:150068316
    Gene:
    CSF1R (GeneView)
    Functional Consequence:
    missense,nc transcript variant
    Validated:
    by frequency
    HGVS:
    NC_000005.10:g.150068316G>A, NC_000005.9:g.149447879G>A, NG_012303.1:g.50057C>T, NM_001288705.1:c.1525C>T, NM_005211.3:c.1525C>T, NP_001275634.1:p.Pro509Ser, NP_005202.2:p.Pro509Ser, NR_109969.1:n.1738C>T, XM_005268375.1:c.1525C>T, XP_005268432.1:p.Pro509Ser, XR_245851.1:n.1705C>T
    2.

    rs781580976 [Homo sapiens]
      CAGCACACAAAAGGGTGCCAGAGCC[A/G]TTGATGAATGTCCATATGACGCTTA
      Chromosome:
      5:150070265
      Gene:
      CSF1R (GeneView)
      Functional Consequence:
      nc transcript variant,synonymous codon
      Validated:
      by frequency
      HGVS:
      NC_000005.10:g.150070265G>A, NC_000005.9:g.149449828G>A, NG_012303.1:g.48108C>T, NM_001288705.1:c.1236C>T, NM_005211.3:c.1236C>T, NP_001275634.1:p.Asn412, NP_005202.2:p.Asn412, NR_109969.1:n.1449C>T, XM_005268375.1:c.1236C>T, XP_005268432.1:p.Asn412, XR_245851.1:n.1416C>T
      4.
      5.

      rs781385572 [Homo sapiens]
        AGCAGGTCCCGGAGCTCCAGGGGCC[A/G]TCCATCCTCCTTGTCCAGGTCTAGG
        Chromosome:
        5:150057364
        Gene:
        CSF1R (GeneView)
        Functional Consequence:
        missense,nc transcript variant
        Validated:
        by cluster,by frequency
        HGVS:
        NC_000005.10:g.150057364G>A, NC_000005.9:g.149436927G>A, NG_012303.1:g.61009C>T, NM_001288705.1:c.2242C>T, NM_005211.3:c.2242C>T, NP_001275634.1:p.Arg748Trp, NP_005202.2:p.Arg748Trp, NR_109969.1:n.2292C>T, XM_005268375.1:c.2242C>T, XP_005268432.1:p.Arg748Trp, XR_245851.1:n.2259C>T
        6.

        rs781341770 [Homo sapiens]
          GGGCGATATCCCCTTGCTCGCAGCA[C/G]GTCAGGTGCTCACTAGAGCTCTCCT
          Chromosome:
          5:150054132
          Gene:
          CSF1R (GeneView)
          Functional Consequence:
          nc transcript variant,synonymous codon
          Validated:
          no info
          HGVS:
          NC_000005.10:g.150054132G>C, NC_000005.9:g.149433695G>C, NG_012303.1:g.64241C>G, NG_021389.1:g.58527G>C, NM_001288705.1:c.2856C>G, NM_005211.3:c.2856C>G, NP_001275634.1:p.Thr952, NP_005202.2:p.Thr952, NR_109969.1:n.2906C>G, XM_005268375.1:c.2856C>G, XP_005268432.1:p.Thr952, XR_245851.1:n.2873C>G
          7.

          rs781316589 [Homo sapiens]
            ACACGACCACCTCCTGTGCTAGCAC[A/G]TTCCAGGGCCGGGCAGGGTCTAGAG
            Chromosome:
            5:150080317
            Gene:
            CSF1R (GeneView)
            Functional Consequence:
            nc transcript variant,synonymous codon
            Validated:
            no info
            HGVS:
            NC_000005.10:g.150080317G>A, NC_000005.9:g.149459880G>A, NG_012303.1:g.38056C>T, NM_001288705.1:c.327C>T, NM_005211.3:c.327C>T, NP_001275634.1:p.Asn109, NP_005202.2:p.Asn109, NR_109969.1:n.540C>T, XM_005268375.1:c.327C>T, XP_005268432.1:p.Asn109, XR_245851.1:n.507C>T
            8.

            rs781314536 [Homo sapiens]
              CTGCTCAGAGCTCAAGTTCAAGTAG[A/G]CACTCTCTGGAAAGCAGAACACACA
              Chromosome:
              5:150073487
              Gene:
              CSF1R (GeneView)
              Functional Consequence:
              missense,nc transcript variant
              Validated:
              no info
              HGVS:
              NC_000005.10:g.150073487G>A, NC_000005.9:g.149453050G>A, NG_012303.1:g.44886C>T, NM_001288705.1:c.896C>T, NM_005211.3:c.896C>T, NP_001275634.1:p.Ala299Val, NP_005202.2:p.Ala299Val, NR_109969.1:n.1109C>T, XM_005268375.1:c.896C>T, XP_005268432.1:p.Ala299Val, XR_245851.1:n.1076C>T
              9.

              rs781313374 [Homo sapiens]
                CCTCACCTTTGACATAGAGGTGGAT[A/G]GCGGCGCTGCCTCCCAGGGGGTCTC
                Chromosome:
                5:150080786
                Gene:
                CSF1R (GeneView)
                Functional Consequence:
                nc transcript variant,synonymous codon
                Validated:
                no info
                HGVS:
                NC_000005.10:g.150080786G>A, NC_000005.9:g.149460349G>A, NG_012303.1:g.37587C>T, NM_001288705.1:c.288C>T, NM_005211.3:c.288C>T, NP_001275634.1:p.Ala96, NP_005202.2:p.Ala96, NR_109969.1:n.501C>T, XM_005268375.1:c.288C>T, XP_005268432.1:p.Ala96, XR_245851.1:n.468C>T
                10.

                rs781229473 [Homo sapiens]
                  GGCCACGCACACGCACCAGCGAGAC[A/G]CCTGCTTCCAGCACCGGGTCTGTGA
                  Chromosome:
                  5:150080233
                  Gene:
                  CSF1R (GeneView)
                  Functional Consequence:
                  nc transcript variant,synonymous codon
                  Validated:
                  no info
                  HGVS:
                  NC_000005.10:g.150080233G>A, NC_000005.9:g.149459796G>A, NG_012303.1:g.38140C>T, NM_001288705.1:c.411C>T, NM_005211.3:c.411C>T, NP_001275634.1:p.Gly137, NP_005202.2:p.Gly137, NR_109969.1:n.624C>T, XM_005268375.1:c.411C>T, XP_005268432.1:p.Gly137, XR_245851.1:n.591C>T
                  11.

                  rs781108577 [Homo sapiens]
                    CCCTCATAGCTCTCGATGATCTTCC[A/T]GCGGACCTGGTACTTGGGCTTCTGC
                    Chromosome:
                    5:150061828
                    Gene:
                    CSF1R (GeneView)
                    Functional Consequence:
                    missense,nc transcript variant
                    Validated:
                    no info
                    HGVS:
                    NC_000005.10:g.150061828A>T, NC_000005.9:g.149441391A>T, NG_012303.1:g.56545T>A, NM_001288705.1:c.1648T>A, NM_005211.3:c.1648T>A, NP_001275634.1:p.Trp550Arg, NP_005202.2:p.Trp550Arg, NR_109969.1:n.1861T>A, XM_005268375.1:c.1648T>A, XP_005268432.1:p.Trp550Arg, XR_245851.1:n.1828T>A
                    12.

                    rs781080752 [Homo sapiens]
                      CCAGGGCCAGGTTCCTACTCACATT[C/T]TTGGAAGCGAGGAAGGCCATGCCCT
                      Chromosome:
                      5:150057290
                      Gene:
                      CSF1R (GeneView)
                      Functional Consequence:
                      nc transcript variant,synonymous codon
                      Validated:
                      by frequency
                      HGVS:
                      NC_000005.10:g.150057290C>T, NC_000005.9:g.149436853C>T, NG_012303.1:g.61083G>A, NM_001288705.1:c.2316G>A, NM_005211.3:c.2316G>A, NP_001275634.1:p.Lys772, NP_005202.2:p.Lys772, NR_109969.1:n.2366G>A, XM_005268375.1:c.2316G>A, XP_005268432.1:p.Lys772, XR_245851.1:n.2333G>A
                      13.

                      rs781021919 [Homo sapiens]
                        AGCGATAGGTCCCCGTGTTTTGGAA[A/G]GTAGCGTTGTTGGTGCTGAGGATGC
                        Chromosome:
                        5:150080849
                        Gene:
                        CSF1R (GeneView)
                        Functional Consequence:
                        nc transcript variant,synonymous codon
                        Validated:
                        by frequency
                        HGVS:
                        NC_000005.10:g.150080849G>A, NC_000005.9:g.149460412G>A, NG_012303.1:g.37524C>T, NM_001288705.1:c.225C>T, NM_005211.3:c.225C>T, NP_001275634.1:p.Thr75, NP_005202.2:p.Thr75, NR_109969.1:n.438C>T, XM_005268375.1:c.225C>T, XP_005268432.1:p.Thr75, XR_245851.1:n.405C>T
                        14.

                        rs780917896 [Homo sapiens]
                          GCAGCCTCCCCTCGAATCCGCACCA[C/G]CTCTGCAGGCACCAGTGTCAAGGCT
                          Chromosome:
                          5:150078207
                          Gene:
                          CSF1R (GeneView)
                          Functional Consequence:
                          missense,nc transcript variant
                          Validated:
                          no info
                          HGVS:
                          NC_000005.10:g.150078207G>C, NC_000005.9:g.149457770G>C, NG_012303.1:g.40166C>G, NM_001288705.1:c.634C>G, NM_005211.3:c.634C>G, NP_001275634.1:p.Leu212Val, NP_005202.2:p.Leu212Val, NR_109969.1:n.847C>G, XM_005268375.1:c.634C>G, XP_005268432.1:p.Leu212Val, XR_245851.1:n.814C>G
                          15.

                          rs780914237 [Homo sapiens]
                            CTCCACATAGGTGTCCACACCCTGG[C/G]TGGAGAAGCCACTGTCCCTACATAG
                            Chromosome:
                            5:150057575
                            Gene:
                            CSF1R (GeneView)
                            Functional Consequence:
                            missense,nc transcript variant
                            Validated:
                            no info
                            HGVS:
                            NC_000005.10:g.150057575C>G, NC_000005.9:g.149437138C>G, NG_012303.1:g.60798G>C, NM_001288705.1:c.2150G>C, NM_005211.3:c.2150G>C, NP_001275634.1:p.Ser717Thr, NP_005202.2:p.Ser717Thr, NR_109969.1:n.2200G>C, XM_005268375.1:c.2150G>C, XP_005268432.1:p.Ser717Thr, XR_245851.1:n.2167G>C
                            16.

                            rs780804532 [Homo sapiens]
                              ATAGGACCAGACGTCGCTCTGAACC[A/G]TGTAGACACAGTCAAAGATGCTCTC
                              Chromosome:
                              5:150056082
                              Gene:
                              CSF1R (GeneView)
                              Functional Consequence:
                              missense,nc transcript variant
                              Validated:
                              no info
                              HGVS:
                              NC_000005.10:g.150056082G>A, NC_000005.9:g.149435645G>A, NG_012303.1:g.62291C>T, NM_001288705.1:c.2498C>T, NM_005211.3:c.2498C>T, NP_001275634.1:p.Thr833Met, NP_005202.2:p.Thr833Met, NR_109969.1:n.2548C>T, XM_005268375.1:c.2498C>T, XP_005268432.1:p.Thr833Met, XR_245851.1:n.2515C>T
                              17.

                              rs780629827 [Homo sapiens]
                                CAGGCTGGTGGTCAGAAAAGGGTCC[A/C]AGGTAGGTCCAGTTAAAACCTTGCA
                                Chromosome:
                                5:150073366
                                Gene:
                                CSF1R (GeneView)
                                Functional Consequence:
                                nc transcript variant,synonymous codon
                                Validated:
                                no info
                                HGVS:
                                NC_000005.10:g.150073366C>A, NC_000005.9:g.149452929C>A, NG_012303.1:g.45007G>T, NM_001288705.1:c.1017G>T, NM_005211.3:c.1017G>T, NP_001275634.1:p.Leu339, NP_005202.2:p.Leu339, NR_109969.1:n.1230G>T, XM_005268375.1:c.1017G>T, XP_005268432.1:p.Leu339, XR_245851.1:n.1197G>T
                                18.

                                rs780620310 [Homo sapiens]
                                  CCACTGGTGTGAAGAGGAACTCATC[C/T]GGGGGATGCGTGTGGGCTCCTGGAA
                                  Chromosome:
                                  5:150068311
                                  Gene:
                                  CSF1R (GeneView)
                                  Functional Consequence:
                                  nc transcript variant,synonymous codon
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000005.10:g.150068311C>T, NC_000005.9:g.149447874C>T, NG_012303.1:g.50062G>A, NM_001288705.1:c.1530G>A, NM_005211.3:c.1530G>A, NP_001275634.1:p.Pro510, NP_005202.2:p.Pro510, NR_109969.1:n.1743G>A, XM_005268375.1:c.1530G>A, XP_005268432.1:p.Pro510, XR_245851.1:n.1710G>A
                                  19.

                                  rs780547939 [Homo sapiens]
                                    CATCAGGGCACTGCATTGATAGTCC[C/T]GGCTCTGAATGAACTTGGCCCTGTG
                                    Chromosome:
                                    5:150080126
                                    Gene:
                                    CSF1R (GeneView)
                                    Functional Consequence:
                                    missense,nc transcript variant
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000005.10:g.150080126T>C, NC_000005.9:g.149459689T>C, NG_012303.1:g.38247A>G, NM_001288705.1:c.518A>G, NM_005211.3:c.518A>G, NP_001275634.1:p.Gln173Arg, NP_005202.2:p.Gln173Arg, NR_109969.1:n.731A>G, XM_005268375.1:c.518A>G, XP_005268432.1:p.Gln173Arg, XR_245851.1:n.698A>G
                                    20.

                                    rs780432496 [Homo sapiens]
                                      AGGGCTCCTGGCTCAGGACCTCAGG[A/G]TATGGGTCATCCCAGACCTGCAGCA
                                      Chromosome:
                                      5:150070021
                                      Gene:
                                      CSF1R (GeneView)
                                      Functional Consequence:
                                      nc transcript variant,synonymous codon
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000005.10:g.150070021G>A, NC_000005.9:g.149449584G>A, NG_012303.1:g.48352C>T, NM_001288705.1:c.1362C>T, NM_005211.3:c.1362C>T, NP_001275634.1:p.Tyr454, NP_005202.2:p.Tyr454, NR_109969.1:n.1575C>T, XM_005268375.1:c.1362C>T, XP_005268432.1:p.Tyr454, XR_245851.1:n.1542C>T

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center