Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 464

1.

rs781585106 [Homo sapiens]
    ACTCAGAGGGAGATTTTTCTGATCC[C/T]TGTTCGTGTGACACTAGCGACGACA
    Chromosome:
    15:38351499
    Gene:
    SPRED1 (GeneView)
    Functional Consequence:
    synonymous codon
    Validated:
    by frequency
    HGVS:
    NC_000015.10:g.38351499C>T, NC_000015.9:g.38643700C>T, NG_008980.1:g.103649C>T, NM_152594.2:c.1170C>T, NP_689807.1:p.Pro390, XM_005254202.1:c.1206C>T, XM_005254202.3:c.1206C>T, XM_005254203.1:c.948C>T, XM_011521289.2:c.1107C>T, XP_005254259.1:p.Pro402, XP_005254260.1:p.Pro316, XP_011519591.1:p.Pro369
    2.
    4.

    rs781366830 [Homo sapiens]
      TTTGAGACGGAGTTTCACTCTTGTT[A/G]CCCAGGCTGGAGTGCAATGGTGCGA
      Chromosome:
      15:38354995
      Gene:
      SPRED1 (GeneView)
      Functional Consequence:
      utr variant 3 prime
      Validated:
      no info
      HGVS:
      NC_000015.10:g.38354995G>A, NC_000015.9:g.38647196G>A, NG_008980.1:g.107145G>A, NM_152594.2:c.*3331G>A, XM_005254202.1:c.*3331G>A, XM_005254202.3:c.*3331G>A, XM_005254203.1:c.*3331G>A, XM_011521289.2:c.*3331G>A
      5.

      rs781241994 [Homo sapiens]
        TGTTGCTCCTCCATCTCCAGATCGG[A/T]TCACGGTGAGGGAAAGATGAGCGAG
        Chromosome:
        15:38253169
        Gene:
        LOC107984760 (GeneView) SPRED1 (GeneView)
        Functional Consequence:
        intron variant,utr variant 5 prime
        Validated:
        no info
        HGVS:
        NC_000015.10:g.38253169A>T, NC_000015.9:g.38545370A>T, NG_008980.1:g.5319A>T, NM_152594.2:c.-17A>T, XM_005254202.1:c.-17A>T, XM_005254202.3:c.-17A>T, XM_005254203.1:c.-64A>T, XR_001751484.1:n.87+398T>A
        6.

        rs781111622 [Homo sapiens]
          ATGTTAGCCATTATTCCTGAAAGCT[G/T]CTTAAATTGCATCAGTTGTTTTGAA
          Chromosome:
          15:38356040
          Gene:
          SPRED1 (GeneView)
          Functional Consequence:
          utr variant 3 prime
          Validated:
          no info
          HGVS:
          NC_000015.10:g.38356040T>G, NC_000015.9:g.38648241T>G, NG_008980.1:g.108190T>G, NM_152594.2:c.*4376T>G, XM_005254202.1:c.*4376T>G, XM_005254202.3:c.*4376T>G, XM_005254203.1:c.*4376T>G, XM_011521289.2:c.*4376T>G
          7.
          8.

          rs780614363 [Homo sapiens]
            TAATAGTTATGCACGAGTGCGAGCT[C/G]TGGTGATGACCCGAGATGACTCAAG
            Chromosome:
            15:38299398
            Gene:
            SPRED1 (GeneView)
            Functional Consequence:
            missense,utr variant 5 prime
            Validated:
            no info
            HGVS:
            NC_000015.10:g.38299398G>C, NC_000015.9:g.38591599G>C, NG_008980.1:g.51548G>C, NM_152594.2:c.58G>C, NP_689807.1:p.Val20Leu, XM_005254202.1:c.94G>C, XM_005254202.3:c.94G>C, XM_005254203.1:c.-15-22843G>C, XM_011521289.2:c.-6G>C, XP_005254259.1:p.Val32Leu
            9.
            10.
            11.
            12.
            13.
            14.

            rs779337443 [Homo sapiens]
              CATATAAATTTATTTCTTTTGCAGA[C/G]CATTATATTACTGGATGTTTAATTT
              Chromosome:
              15:38352941
              Gene:
              SPRED1 (GeneView)
              Functional Consequence:
              utr variant 3 prime
              Validated:
              no info
              HGVS:
              NC_000015.10:g.38352941G>C, NC_000015.9:g.38645142G>C, NG_008980.1:g.105091G>C, NM_152594.2:c.*1277G>C, XM_005254202.1:c.*1277G>C, XM_005254202.3:c.*1277G>C, XM_005254203.1:c.*1277G>C, XM_011521289.2:c.*1277G>C
              16.
              17.

              rs778868909 [Homo sapiens]
                GCCCCGAATCAAAAAATGAAGCTGA[A/G]GGGGCAGATGACTTACAAGTAAGTA
                Chromosome:
                15:38324791
                Gene:
                SPRED1 (GeneView)
                Functional Consequence:
                synonymous codon
                Validated:
                no info
                HGVS:
                NC_000015.10:g.38324791A>G, NC_000015.9:g.38616992A>G, NG_008980.1:g.76941A>G, NM_152594.2:c.405A>G, NP_689807.1:p.Glu135, XM_005254202.1:c.441A>G, XM_005254202.3:c.441A>G, XM_005254203.1:c.183A>G, XM_011521289.2:c.342A>G, XP_005254259.1:p.Glu147, XP_005254260.1:p.Glu61, XP_011519591.1:p.Glu114
                18.

                rs778847063 [Homo sapiens]
                  AGTGGACTAAGCAGCGTCACTGTCT[G/T]CAAAGTCCCTCATCAGGAAGAGAAT
                  Chromosome:
                  15:38299474
                  Gene:
                  SPRED1 (GeneView)
                  Functional Consequence:
                  missense
                  Validated:
                  no info
                  HGVS:
                  NC_000015.10:g.38299474T>G, NC_000015.9:g.38591675T>G, NG_008980.1:g.51624T>G, NM_152594.2:c.134T>G, NP_689807.1:p.Phe45Cys, XM_005254202.1:c.170T>G, XM_005254202.3:c.170T>G, XM_005254203.1:c.-15-22767T>G, XM_011521289.2:c.71T>G, XP_005254259.1:p.Phe57Cys, XP_011519591.1:p.Phe24Cys
                  19.

                  rs778489832 [Homo sapiens]
                    ATTTCTAGTTTTGTACTAAAAATCA[A/G]TTGGATGAACTAAATCCAAAACATG
                    Chromosome:
                    15:38353501
                    Gene:
                    SPRED1 (GeneView)
                    Functional Consequence:
                    utr variant 3 prime
                    Validated:
                    no info
                    HGVS:
                    NC_000015.10:g.38353501A>G, NC_000015.9:g.38645702A>G, NG_008980.1:g.105651A>G, NM_152594.2:c.*1837A>G, XM_005254202.1:c.*1837A>G, XM_005254202.3:c.*1837A>G, XM_005254203.1:c.*1837A>G, XM_011521289.2:c.*1837A>G

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center