Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 944

2.

rs796626411 has merged into rs762830945 [Homo sapiens]
    TAATTTTTGTTTATTTATTTATTTA[-/T/TT/TTT]TTTTTTTTGTAGAGATGGGGTTTTG
    Chromosome:
    1:161236915
    Gene:
    NR1I3 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by cluster
    HGVS:
    CM000663.2:g.161236915_161236916insAT, CM000663.2:g.161236915_161236916insT, CM000663.2:g.161236915_161236916insTT, CM000663.2:g.161236915_161236916insTTT, NC_000001.10:g.161206705_161206706insTT, NC_000001.11:g.161236915_161236916insAT, NC_000001.11:g.161236915_161236916insT, NC_000001.11:g.161236915_161236916insTT, NC_000001.11:g.161236915_161236916insTTT, NG_029113.1:g.6295_6296insA, NG_029113.1:g.6295_6296insAA, NG_029113.1:g.6295_6296insAAA, NG_029113.1:g.6295_6296insAT, NM_001077469.2:c.-33-318_-33-317insA, NM_001077469.2:c.-33-318_-33-317insAA, NM_001077469.2:c.-33-318_-33-317insAAA, NM_001077469.2:c.-33-318_-33-317insAT, NM_001077470.2:c.21-939_21-938insA, NM_001077470.2:c.21-939_21-938insAA, NM_001077470.2:c.21-939_21-938insAAA, NM_001077470.2:c.21-939_21-938insAT, NM_001077471.2:c.-33-318_-33-317insA, NM_001077471.2:c.-33-318_-33-317insAA, NM_001077471.2:c.-33-318_-33-317insAAA, NM_001077471.2:c.-33-318_-33-317insAT, NM_001077472.2:c.21-939_21-938insA, NM_001077472.2:c.21-939_21-938insAA, NM_001077472.2:c.21-939_21-938insAAA, NM_001077472.2:c.21-939_21-938insAT, NM_001077473.2:c.21-939_21-938insA, NM_001077473.2:c.21-939_21-938insAA, NM_001077473.2:c.21-939_21-938insAAA, NM_001077473.2:c.21-939_21-938insAT, NM_001077474.2:c.-33-318_-33-317insA, NM_001077474.2:c.-33-318_-33-317insAA, NM_001077474.2:c.-33-318_-33-317insAAA, NM_001077474.2:c.-33-318_-33-317insAT, NM_001077475.2:c.21-939_21-938insA, NM_001077475.2:c.21-939_21-938insAA, NM_001077475.2:c.21-939_21-938insAAA, NM_001077475.2:c.21-939_21-938insAT, NM_001077476.2:c.21-939_21-938insA, NM_001077476.2:c.21-939_21-938insAA, NM_001077476.2:c.21-939_21-938insAAA, NM_001077476.2:c.21-939_21-938insAT, NM_001077477.2:c.21-939_21-938insA, NM_001077477.2:c.21-939_21-938insAA, NM_001077477.2:c.21-939_21-938insAAA, NM_001077477.2:c.21-939_21-938insAT, NM_001077478.2:c.-33-318_-33-317insA, NM_001077478.2:c.-33-318_-33-317insAA, NM_001077478.2:c.-33-318_-33-317insAAA, NM_001077478.2:c.-33-318_-33-317insAT, NM_001077479.2:c.21-939_21-938insA, NM_001077479.2:c.21-939_21-938insAA, NM_001077479.2:c.21-939_21-938insAAA, NM_001077479.2:c.21-939_21-938insAT, NM_001077480.2:c.-33-318_-33-317insA, NM_001077480.2:c.-33-318_-33-317insAA, NM_001077480.2:c.-33-318_-33-317insAAA, NM_001077480.2:c.-33-318_-33-317insAT, NM_001077481.2:c.-33-318_-33-317insA, NM_001077481.2:c.-33-318_-33-317insAA, NM_001077481.2:c.-33-318_-33-317insAAA, NM_001077481.2:c.-33-318_-33-317insAT, NM_001077482.2:c.-33-318_-33-317insA, NM_001077482.2:c.-33-318_-33-317insAA, NM_001077482.2:c.-33-318_-33-317insAAA, NM_001077482.2:c.-33-318_-33-317insAT, NM_005122.4:c.-33-318_-33-317insA, NM_005122.4:c.-33-318_-33-317insAA, NM_005122.4:c.-33-318_-33-317insAAA, NM_005122.4:c.-33-318_-33-317insAT
    5.

    rs796448043 has merged into rs760634188 [Homo sapiens]
      CTAATTTTTGTTTATTTATTTATTT[-/TT]ATTTTTTTTGTAGAGATGGGGTTTT
      Chromosome:
      1:161236914
      Gene:
      NR1I3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by cluster
      HGVS:
      CM000663.2:g.161236914_161236915insTA, CM000663.2:g.161236914_161236915insTT, NC_000001.10:g.161206704_161206705insTA, NC_000001.10:g.161206704_161206705insTT, NC_000001.11:g.161236914_161236915insTA, NC_000001.11:g.161236914_161236915insTT, NG_029113.1:g.6296_6297insAA, NG_029113.1:g.6296_6297insTA, NM_001077469.2:c.-33-317_-33-316insAA, NM_001077469.2:c.-33-317_-33-316insTA, NM_001077470.2:c.21-938_21-937insAA, NM_001077470.2:c.21-938_21-937insTA, NM_001077471.2:c.-33-317_-33-316insAA, NM_001077471.2:c.-33-317_-33-316insTA, NM_001077472.2:c.21-938_21-937insAA, NM_001077472.2:c.21-938_21-937insTA, NM_001077473.2:c.21-938_21-937insAA, NM_001077473.2:c.21-938_21-937insTA, NM_001077474.2:c.-33-317_-33-316insAA, NM_001077474.2:c.-33-317_-33-316insTA, NM_001077475.2:c.21-938_21-937insAA, NM_001077475.2:c.21-938_21-937insTA, NM_001077476.2:c.21-938_21-937insAA, NM_001077476.2:c.21-938_21-937insTA, NM_001077477.2:c.21-938_21-937insAA, NM_001077477.2:c.21-938_21-937insTA, NM_001077478.2:c.-33-317_-33-316insAA, NM_001077478.2:c.-33-317_-33-316insTA, NM_001077479.2:c.21-938_21-937insAA, NM_001077479.2:c.21-938_21-937insTA, NM_001077480.2:c.-33-317_-33-316insAA, NM_001077480.2:c.-33-317_-33-316insTA, NM_001077481.2:c.-33-317_-33-316insAA, NM_001077481.2:c.-33-317_-33-316insTA, NM_001077482.2:c.-33-317_-33-316insAA, NM_001077482.2:c.-33-317_-33-316insTA, NM_005122.4:c.-33-317_-33-316insAA, NM_005122.4:c.-33-317_-33-316insTA
      11.

      rs781436406 [Homo sapiens]
        AACTTGATGACTTGCAGTACCATGA[A/C/G]AGTGTTGATGTCTGCGAAGTGTGTG
        Chromosome:
        1:161232856
        Gene:
        NR1I3 (GeneView)
        Functional Consequence:
        missense
        Validated:
        no info
        HGVS:
        CM000663.2:g.161232856A>C, CM000663.2:g.161232856A>G, NC_000001.10:g.161202646A>C, NC_000001.11:g.161232856A>C, NC_000001.11:g.161232856A>G, NG_029113.1:g.10355T>C, NG_029113.1:g.10355T>G, NM_001077469.2:c.499T>C, NM_001077469.2:c.499T>G, NM_001077470.2:c.412T>C, NM_001077470.2:c.412T>G, NM_001077471.2:c.499T>C, NM_001077471.2:c.499T>G, NM_001077472.2:c.412T>C, NM_001077472.2:c.412T>G, NM_001077473.2:c.412T>C, NM_001077473.2:c.412T>G, NM_001077474.2:c.499T>C, NM_001077474.2:c.499T>G, NM_001077475.2:c.412T>C, NM_001077475.2:c.412T>G, NM_001077476.2:c.412T>C, NM_001077476.2:c.412T>G, NM_001077477.2:c.412T>C, NM_001077477.2:c.412T>G, NM_001077478.2:c.499T>C, NM_001077478.2:c.499T>G, NM_001077479.2:c.412T>C, NM_001077479.2:c.412T>G, NM_001077480.2:c.499T>C, NM_001077480.2:c.499T>G, NM_001077481.2:c.499T>C, NM_001077481.2:c.499T>G, NM_001077482.2:c.499T>C, NM_001077482.2:c.499T>G, NM_005122.4:c.499T>C, NM_005122.4:c.499T>G, NP_001070937.1:p.Phe167Leu, NP_001070937.1:p.Phe167Val, NP_001070938.1:p.Phe138Leu, NP_001070938.1:p.Phe138Val, NP_001070939.1:p.Phe167Leu, NP_001070939.1:p.Phe167Val, NP_001070940.1:p.Phe138Leu, NP_001070940.1:p.Phe138Val, NP_001070941.1:p.Phe138Leu, NP_001070941.1:p.Phe138Val, NP_001070942.1:p.Phe167Leu, NP_001070942.1:p.Phe167Val, NP_001070943.1:p.Phe138Leu, NP_001070943.1:p.Phe138Val, NP_001070944.1:p.Phe138Leu, NP_001070944.1:p.Phe138Val, NP_001070945.1:p.Phe138Leu, NP_001070945.1:p.Phe138Val, NP_001070946.1:p.Phe167Leu, NP_001070946.1:p.Phe167Val, NP_001070947.1:p.Phe138Leu, NP_001070947.1:p.Phe138Val, NP_001070948.1:p.Phe167Leu, NP_001070948.1:p.Phe167Val, NP_001070949.1:p.Phe167Leu, NP_001070949.1:p.Phe167Val, NP_001070950.1:p.Phe167Leu, NP_001070950.1:p.Phe167Val, NP_005113.1:p.Phe167Leu, NP_005113.1:p.Phe167Val, XP_005245750.1:p.Phe239Leu, XP_005245750.1:p.Phe239Val, XP_005245751.1:p.Phe239Leu, XP_005245751.1:p.Phe239Val, XP_005245752.1:p.Phe239Val, XP_005245753.1:p.Phe209Val, XP_005245754.1:p.Phe167Leu, XP_005245754.1:p.Phe167Val, XP_011508539.1:p.Phe239Leu, XP_011508539.1:p.Phe239Val
        19.

        rs780546014 [Homo sapiens]
          TAAACTGCACAAACTGTTCAAACAT[
          -/GGTGCCCATGTGGCGGGTGTG
          ]GGTGCCCATGTGGCGGGTGTGGGCC
          Chromosome:
          1:161233195
          Gene:
          NR1I3 (GeneView)
          Functional Consequence:
          cds indel
          Validated:
          by frequency
          HGVS:
          CM000663.2:g.161233195_161233196insGGTGCCCATGTGGCGGGTGTG, NC_000001.10:g.161202985_161202986insGGTGCCCATGTGGCGGGTGTG, NC_000001.11:g.161233195_161233196insGGTGCCCATGTGGCGGGTGTG, NG_029113.1:g.10015_10016insCACACCCGCCACATGGGCACC, NM_001077469.2:c.381_382insCACACCCGCCACATGGGCACC, NM_001077470.2:c.294_295insCACACCCGCCACATGGGCACC, NM_001077471.2:c.381_382insCACACCCGCCACATGGGCACC, NM_001077472.2:c.294_295insCACACCCGCCACATGGGCACC, NM_001077473.2:c.294_295insCACACCCGCCACATGGGCACC, NM_001077474.2:c.381_382insCACACCCGCCACATGGGCACC, NM_001077475.2:c.294_295insCACACCCGCCACATGGGCACC, NM_001077476.2:c.294_295insCACACCCGCCACATGGGCACC, NM_001077477.2:c.294_295insCACACCCGCCACATGGGCACC, NM_001077478.2:c.381_382insCACACCCGCCACATGGGCACC, NM_001077479.2:c.294_295insCACACCCGCCACATGGGCACC, NM_001077480.2:c.381_382insCACACCCGCCACATGGGCACC, NM_001077481.2:c.381_382insCACACCCGCCACATGGGCACC, NM_001077482.2:c.381_382insCACACCCGCCACATGGGCACC, NM_005122.4:c.381_382insCACACCCGCCACATGGGCACC, NP_001070937.1:p.Thr127_Met128insHisThrArgHisMetGlyThr, NP_001070938.1:p.Thr98_Met99insHisThrArgHisMetGlyThr, NP_001070939.1:p.Thr127_Met128insHisThrArgHisMetGlyThr, NP_001070940.1:p.Thr98_Met99insHisThrArgHisMetGlyThr, NP_001070941.1:p.Thr98_Met99insHisThrArgHisMetGlyThr, NP_001070942.1:p.Thr127_Met128insHisThrArgHisMetGlyThr, NP_001070943.1:p.Thr98_Met99insHisThrArgHisMetGlyThr, NP_001070944.1:p.Thr98_Met99insHisThrArgHisMetGlyThr, NP_001070945.1:p.Thr98_Met99insHisThrArgHisMetGlyThr, NP_001070946.1:p.Thr127_Met128insHisThrArgHisMetGlyThr, NP_001070947.1:p.Thr98_Met99insHisThrArgHisMetGlyThr, NP_001070948.1:p.Thr127_Met128insHisThrArgHisMetGlyThr, NP_001070949.1:p.Thr127_Met128insHisThrArgHisMetGlyThr, NP_001070950.1:p.Thr127_Met128insHisThrArgHisMetGlyThr, NP_005113.1:p.Thr127_Met128insHisThrArgHisMetGlyThr, XP_005245750.1:p.Thr199_Met200insHisThrArgHisMetGlyThr, XP_005245751.1:p.Thr199_Met200insHisThrArgHisMetGlyThr, XP_005245752.1:p.Thr199_Met200insHisThrArgHisMetGlyThr, XP_005245754.1:p.Thr127_Met128insHisThrArgHisMetGlyThr, XP_011508539.1:p.Thr199_Met200insHisThrArgHisMetGlyThr

          Display Settings:

          Format
          Items per page
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center