Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 10626

1.

rs1491535263 [Homo sapiens]
    GATACACACCGGCATAAGTAAGCCC[
    -/T/TTTT/TTTTT/TTTTTT/TTT
    TTTT/TTTTTTTT
    ]TTTTTTTTTTTTTTTTTTTTTTTTG
    Chromosome:
    13:42579704
    Gene:
    TNFSF11 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    no info
    HGVS:
    CM000675.1:g.43153840_43153841insT, CM000675.1:g.43153840_43153841insTTTT, CM000675.1:g.43153840_43153841insTTTTT, CM000675.1:g.43153840_43153841insTTTTTT, CM000675.1:g.43153840_43153841insTTTTTTT, CM000675.1:g.43153840_43153841insTTTTTTTT, CM000675.2:g.42579704_42579705insT, CM000675.2:g.42579704_42579705insTTTT, CM000675.2:g.42579704_42579705insTTTTT, CM000675.2:g.42579704_42579705insTTTTTT, CM000675.2:g.42579704_42579705insTTTTTTT, CM000675.2:g.42579704_42579705insTTTTTTTT, NC_000013.10:g.43153840_43153841insT, NC_000013.10:g.43153840_43153841insTTTT, NC_000013.10:g.43153840_43153841insTTTTT, NC_000013.10:g.43153840_43153841insTTTTTT, NC_000013.10:g.43153840_43153841insTTTTTTT, NC_000013.10:g.43153840_43153841insTTTTTTTT, NC_000013.11:g.42579704_42579705insT, NC_000013.11:g.42579704_42579705insTTTT, NC_000013.11:g.42579704_42579705insTTTTT, NC_000013.11:g.42579704_42579705insTTTTTT, NC_000013.11:g.42579704_42579705insTTTTTTT, NC_000013.11:g.42579704_42579705insTTTTTTTT, NG_008990.1:g.21969_21970insT, NG_008990.1:g.21969_21970insTTTT, NG_008990.1:g.21969_21970insTTTTT, NG_008990.1:g.21969_21970insTTTTTT, NG_008990.1:g.21969_21970insTTTTTTT, NG_008990.1:g.21969_21970insTTTTTTTT, NM_003701.3:c.220-1422_220-1421insT, NM_003701.3:c.220-1422_220-1421insTTTT, NM_003701.3:c.220-1422_220-1421insTTTTT, NM_003701.3:c.220-1422_220-1421insTTTTTT, NM_003701.3:c.220-1422_220-1421insTTTTTTT, NM_003701.3:c.220-1422_220-1421insTTTTTTTT, NM_033012.3:c.1-1422_1-1421insT, NM_033012.3:c.1-1422_1-1421insTTTT, NM_033012.3:c.1-1422_1-1421insTTTTT, NM_033012.3:c.1-1422_1-1421insTTTTTT, NM_033012.3:c.1-1422_1-1421insTTTTTTT, NM_033012.3:c.1-1422_1-1421insTTTTTTTT
    2.
    3.

    rs1491473241 [Homo sapiens]
      GGATACACACCGGCATAAGTAAGCC[-/CT]TTTTTTTTTTTTTTTTTTTTTTTGC
      Chromosome:
      13:42579704
      Gene:
      TNFSF11 (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      no info
      HGVS:
      CM000675.1:g.43153840_43153841delCT, CM000675.2:g.42579704_42579705delCT, NC_000013.10:g.43153840_43153841delCT, NC_000013.11:g.42579704_42579705delCT, NG_008990.1:g.21969_21970delCT, NM_003701.3:c.220-1422_220-1421delCT, NM_033012.3:c.1-1422_1-1421delCT
      4.

      rs1491449307 [Homo sapiens]
        GGGAAGGTAACTAGTGTGTGTTTCC[-/T]TTTTTTTTGTTTGTTTTGTTTGTTT
        Chromosome:
        13:42604769
        Gene:
        LOC107984612 (GeneView) TNFSF11 (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Validated:
        no info
        HGVS:
        CM000675.1:g.43178905_43178906insT, CM000675.2:g.42604769_42604770insT, NC_000013.10:g.43178905_43178906insT, NC_000013.11:g.42604769_42604770insT, NG_008990.1:g.47034_47035insT, NM_003701.3:c.533-1728_533-1727insT, NM_033012.3:c.314-1728_314-1727insT, XR_001749849.1:n.-1665_-1664insA
        5.

        rs1491131188 [Homo sapiens]
          TATGAGTTAAATAGAAGTTGAAATT[-/TA]AAAAAAAAAATCACATTGGTTGTTT
          Chromosome:
          13:42594948
          Gene:
          TNFSF11 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster
          HGVS:
          CM000675.1:g.43169084_43169085delTA, CM000675.2:g.42594948_42594949delTA, NC_000013.10:g.43169084_43169085delTA, NC_000013.11:g.42594948_42594949delTA, NG_008990.1:g.37213_37214delTA, NG_053973.1:g.1814_1815delTA, NM_003701.3:c.388-5804_388-5803delTA, NM_033012.3:c.169-5804_169-5803delTA
          6.

          rs1491087270 [Homo sapiens]
            CCTTTTTTTTTTTTTTTTTTTTTTT[-/TTTTC]TGCAAAGTGTCTGATTGAAAACTTT
            Chromosome:
            13:42579727
            Gene:
            TNFSF11 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB
            Validated:
            no info
            HGVS:
            CM000675.2:g.42579727_42579728insTTTTC, NC_000013.10:g.43153863_43153864insTTTTC, NC_000013.11:g.42579727_42579728insTTTTC, NG_008990.1:g.21992_21993insTTTTC, NM_003701.3:c.220-1399_220-1398insTTTTC, NM_033012.3:c.1-1399_1-1398insTTTTC
            7.

            rs1491054022 [Homo sapiens]
              GGCAACAGAGCAAAAACTCCGTCTC[-/A]AAAAAAAAAAAAAAAAGGAAGAAAG
              Chromosome:
              13:42563663
              Gene:
              TNFSF11 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              HGVS:
              CM000675.2:g.42563663_42563664insA, NC_000013.10:g.43137799_43137800insA, NC_000013.11:g.42563663_42563664insA, NG_008990.1:g.5928_5929insA, NM_033012.3:c.-302+700_-302+701insA
              8.

              rs1491046637 [Homo sapiens]
                GGTGACAAAGCAAGACCCTGTCTTC[-/AA]AAAAAAAAAAAAAAGGAAAAGAAAA
                Chromosome:
                13:42579416
                Gene:
                TNFSF11 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                no info
                HGVS:
                CM000675.2:g.42579416_42579417delAA, NC_000013.10:g.43153552_43153553delAA, NC_000013.11:g.42579416_42579417delAA, NG_008990.1:g.21681_21682delAA, NM_003701.3:c.220-1710_220-1709delAA, NM_033012.3:c.1-1710_1-1709delAA
                9.

                rs1491041071 [Homo sapiens]
                  CTGGGTGACATAGCAAGACCCTGCT[-/AA]AAAAAAAAAAAAAAAAAAAGAAAGG
                  Chromosome:
                  13:42583418
                  Gene:
                  TNFSF11 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  no info
                  HGVS:
                  CM000675.2:g.42583418_42583419delAA, NC_000013.10:g.43157554_43157555delAA, NC_000013.11:g.42583418_42583419delAA, NG_008990.1:g.25683_25684delAA, NM_003701.3:c.387+2125_387+2126delAA, NM_033012.3:c.168+2125_168+2126delAA
                  10.

                  rs1490933262 [Homo sapiens]
                    ACCTGGAGGAACACCTGACATTTTA[C/T]ACCTTACTGTGGTAAGGAAGAATTA
                    Chromosome:
                    13:42608440
                    Gene:
                    TNFSF11 (GeneView)
                    Functional Consequence:
                    downstream variant 500B
                    Validated:
                    no info
                    HGVS:
                    CM000675.2:g.42608440T>C, NC_000013.10:g.43182576T>C, NC_000013.11:g.42608440T>C, NG_008990.1:g.50705T>C, NM_003701.3:c.*1095+427T>C, NM_033012.3:c.*1095+427T>C
                    11.

                    rs1490902900 [Homo sapiens]
                      TGTAGAATTCAGAATTCACAATATC[C/T]TCTGATATTAAGATTAATATACCCA
                      Chromosome:
                      13:42586923
                      Gene:
                      TNFSF11 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      HGVS:
                      CM000675.2:g.42586923C>T, NC_000013.10:g.43161059C>T, NC_000013.11:g.42586923C>T, NG_008990.1:g.29188C>T, NM_003701.3:c.387+5630C>T, NM_033012.3:c.168+5630C>T
                      12.

                      rs1490882841 [Homo sapiens]
                        CAGAATGGATGCTTATTTTAAATGA[C/T]TGCCAGCTGAAAGCCTGTAACCTGG
                        Chromosome:
                        13:42601229
                        Gene:
                        LOC107984612 (GeneView) TNFSF11 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        CM000675.2:g.42601229C>T, NC_000013.10:g.43175365C>T, NC_000013.11:g.42601229C>T, NG_008990.1:g.43494C>T, NM_003701.3:c.532+248C>T, NM_033012.3:c.313+248C>T, XR_001749849.1:n.1594-226G>A
                        13.

                        rs1490818089 [Homo sapiens]
                          ATTGTACTTGCACTTTGCCTTCAAA[A/G]TACTAATCACGGTTTTGTTAGTGAT
                          Chromosome:
                          13:42570946
                          Gene:
                          TNFSF11 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          no info
                          HGVS:
                          CM000675.2:g.42570946G>A, NC_000013.10:g.43145082G>A, NC_000013.11:g.42570946G>A, NG_008990.1:g.13211G>A, NM_033012.3:c.-159-634G>A
                          14.

                          rs1490816410 [Homo sapiens]
                            GGTCACTCGCAAGCTCAGTGTTTTC[C/T]TGCTTCTTTGAGAGGAGAGCTCTTT
                            Chromosome:
                            13:42590340
                            Gene:
                            TNFSF11 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            no info
                            HGVS:
                            CM000675.2:g.42590340C>T, NC_000013.10:g.43164476C>T, NC_000013.11:g.42590340C>T, NG_008990.1:g.32605C>T, NM_003701.3:c.387+9047C>T, NM_033012.3:c.168+9047C>T
                            15.

                            rs1490776016 [Homo sapiens]
                              AATTAAATAATTATACATATTCCAC[C/G]TTTTTCCTACAAATAATTTAAGGCA
                              Chromosome:
                              13:42602376
                              Gene:
                              LOC107984612 (GeneView) TNFSF11 (GeneView)
                              Functional Consequence:
                              intron variant,nc transcript variant
                              Validated:
                              no info
                              HGVS:
                              CM000675.2:g.42602376C>G, NC_000013.10:g.43176512C>G, NC_000013.11:g.42602376C>G, NG_008990.1:g.44641C>G, NM_003701.3:c.532+1395C>G, NM_033012.3:c.313+1395C>G, XR_001749849.1:n.730G>C
                              16.

                              rs1490766887 [Homo sapiens]
                                TCTGTGGTTCATTGCATCCACAGAT[A/G]TGGAACCCATGGATACTGTGGGCTA
                                Chromosome:
                                13:42573213
                                Gene:
                                TNFSF11 (GeneView)
                                Functional Consequence:
                                intron variant,upstream variant 2KB
                                Validated:
                                no info
                                HGVS:
                                CM000675.2:g.42573213G>A, NC_000013.10:g.43147349G>A, NC_000013.11:g.42573213G>A, NG_008990.1:g.15478G>A, NM_003701.3:c.-1091G>A, NM_033012.3:c.-1+1475G>A
                                17.

                                rs1490736818 [Homo sapiens]
                                  TCGTTCAGTCAGTTCGTGGGCATTT[A/G]CTGAGGGTCCAGCATCAGTCTGGCT
                                  Chromosome:
                                  13:42578298
                                  Gene:
                                  TNFSF11 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  no info
                                  HGVS:
                                  CM000675.2:g.42578298G>A, NC_000013.10:g.43152434G>A, NC_000013.11:g.42578298G>A, NG_008990.1:g.20563G>A, NM_003701.3:c.220-2828G>A, NM_033012.3:c.1-2828G>A
                                  18.

                                  rs1490601554 [Homo sapiens]
                                    TGATAAGCCCAGACTCCAGCAACTT[C/G]ACCTTTTCAGAATATCTTTGCAGCT
                                    Chromosome:
                                    13:42594010
                                    Gene:
                                    TNFSF11 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    no info
                                    HGVS:
                                    CM000675.2:g.42594010G>C, NC_000013.10:g.43168146G>C, NC_000013.11:g.42594010G>C, NG_008990.1:g.36275G>C, NG_053973.1:g.876G>C, NM_003701.3:c.388-6742G>C, NM_033012.3:c.169-6742G>C
                                    19.

                                    rs1490416515 [Homo sapiens]
                                      CAAAAAGGAGTGGAAGGAGATGAGG[A/G]GACAATGAGCAGTCTCTGACATTCA
                                      Chromosome:
                                      13:42587395
                                      Gene:
                                      TNFSF11 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      HGVS:
                                      CM000675.2:g.42587395G>A, NC_000013.10:g.43161531G>A, NC_000013.11:g.42587395G>A, NG_008990.1:g.29660G>A, NM_003701.3:c.387+6102G>A, NM_033012.3:c.168+6102G>A
                                      20.

                                      rs1490399012 [Homo sapiens]
                                        TGTTTTCCCCTTCCTCAATACCTCT[C/T]ATCCTTACTGCAATCCTGCAAGGTA
                                        Chromosome:
                                        13:42601829
                                        Gene:
                                        LOC107984612 (GeneView) TNFSF11 (GeneView)
                                        Functional Consequence:
                                        intron variant,nc transcript variant
                                        Validated:
                                        no info
                                        HGVS:
                                        CM000675.2:g.42601829C>T, NC_000013.10:g.43175965C>T, NC_000013.11:g.42601829C>T, NG_008990.1:g.44094C>T, NM_003701.3:c.532+848C>T, NM_033012.3:c.313+848C>T, XR_001749849.1:n.1277G>A

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center