Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 13843

1.

rs797015957 [Homo sapiens]
    CTGTGTGTCTGTGTCTGTGTGTGTC[-/TGTG]TGTGTGTGTCTATGTGCATGTGTAT
    Chromosome:
    16:88334069
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000016.10:g.88334069_88334072delTGTG, NC_000016.9:g.88367675_88367678delTGTG
    2.

    rs797001563 [Homo sapiens]
      CCTGTAGACCCCGTGACCCACCCGA[C/T]CAGAGGTTGTGAGCTGCCATCCAAC
      Chromosome:
      16:88438083
      Gene:
      ZNF469 (GeneView)
      Functional Consequence:
      missense
      Validated:
      by cluster,by frequency
      HGVS:
      NC_000016.10:g.88438083T>C, NC_000016.9:g.88504491T>C, NG_012236.2:g.15613T>C, NM_001127464.2:c.10529T>C, NP_001120936.2:p.Ile3510Thr, XM_017023784.1:c.10613T>C, XM_017023785.1:c.10613T>C, XP_016879273.1:p.Ile3538Thr, XP_016879274.1:p.Ile3538Thr
      3.

      rs796998290 [Homo sapiens]
        ATGAATTGATGGGTGGATGGGTAAG[
        -/TGGATGAGTGGGTGAATGGATGG
        TTGGA
        ]TGGATGAGTGGGTGGATGGGTAGCT
        Chromosome:
        16:88244725
        Validated:
        no info
        HGVS:
        NC_000016.10:g.88244725_88244726insTGGATGAGTGGGTGAATGGATGGTTGGA, NC_000016.9:g.88278331_88278332insTGGATGAGTGGGTGAATGGATGGTTGGA
        4.

        rs796993742 [Homo sapiens]
          CGTCTCTAGGCCCTTGTCCCCGCTA[A/G]GGGAAGAGCACAGCACTGTCCCACC
          Chromosome:
          16:88355001
          Validated:
          no info
          HGVS:
          NC_000016.10:g.88355001G>A, NC_000016.9:g.88388607G>A
          5.

          rs796992303 [Homo sapiens]
            ATCCCAACTGCAGGTTCAGCTCTCA[A/G]CCATGCTGTCCTTCCCCAGTGCCAT
            Chromosome:
            16:88420024
            Validated:
            no info
            HGVS:
            NC_000016.10:g.88420024G>A, NC_000016.9:g.88486432G>A
            6.

            rs796989648 [Homo sapiens]
              TGTCTGACTTCCCGGCGTAGATGCT[A/C]CAGGTGCACCCAGTCATTCTCCTGC
              Chromosome:
              16:88269878
              Validated:
              no info
              HGVS:
              NC_000016.10:g.88269878C>A, NC_000016.9:g.88303484C>A
              7.

              rs796985093 [Homo sapiens]
                GGTGATGATGGTGAGGGTGATGGTG[A/G]TGATGATGGTGATGAGGATGATGGT
                Chromosome:
                16:88289288
                Validated:
                no info
                HGVS:
                NC_000016.10:g.88289288A>G, NC_000016.9:g.88322894A>G
                8.

                rs796983720 [Homo sapiens]
                  CTGCCAGTCACCCTCCCTGCCCTCT[G/T]TGCTCCTGCCACGCACCCTCCCTGC
                  Chromosome:
                  16:88237231
                  Validated:
                  by cluster
                  HGVS:
                  NC_000016.10:g.88237231G>T, NC_000016.9:g.88270837G>T
                  9.

                  rs796977394 [Homo sapiens]
                    TCACAAATGCACACACACGAGGCAC[A/C]ATACACACCACACACAAGTGCACAC
                    Chromosome:
                    16:88349835
                    Validated:
                    by cluster
                    HGVS:
                    NC_000016.10:g.88349835C>A, NC_000016.9:g.88383441C>A
                    10.

                    rs796958331 [Homo sapiens]
                      ACACAAACACACACACAGACACACA[-/CT]CACACACAAATGCACTCACAGACAT
                      Chromosome:
                      16:88380142
                      Validated:
                      no info
                      HGVS:
                      NC_000016.10:g.88380142_88380143delCT, NC_000016.9:g.88446550_88446551delCT
                      11.

                      rs796942611 [Homo sapiens]
                        AGACTCTGTCTCAAAAAAAAAAAAA[-/A]TTATATTTGGTTCACAGACTTAAAA
                        Chromosome:
                        16:88236867
                        Validated:
                        no info
                        HGVS:
                        NC_000016.10:g.88236867delA, NC_000016.9:g.88270473delA
                        12.

                        rs796936575 [Homo sapiens]
                          TGCACTCACACACAGAGACATGCAT[CT/TTCA]ACACACGCACTCACACACAGACATG
                          Chromosome:
                          16:88381387
                          Validated:
                          no info
                          HGVS:
                          NC_000016.10:g.88381387_88381390delTTCAinsCT, NC_000016.9:g.88447795_88447798delTTCAinsCT
                          13.

                          rs796921199 [Homo sapiens]
                            CACTCACACACATGCATTCACAGAC[-/AC]ACACACAGACATGCACTCACACACG
                            Chromosome:
                            16:88381208
                            Validated:
                            by 1000G
                            HGVS:
                            NC_000016.10:g.88381208_88381209delAC, NC_000016.9:g.88447616_88447617delAC
                            14.

                            rs796917597 [Homo sapiens]
                              GATTATGATGATGCTGGTGTGGACT[A/G]TCATCTCTGTAATTCAGGCAGTGCT
                              Chromosome:
                              16:88314937
                              Validated:
                              no info
                              HGVS:
                              NC_000016.10:g.88314937G>A, NC_000016.9:g.88348543G>A
                              15.

                              rs796905286 [Homo sapiens]
                                GAGTTAGAAACCTTTGCATTTATTC[A/T]TCTGGACTCCCCCACATTGCAGATG
                                Chromosome:
                                16:88248720
                                Validated:
                                no info
                                HGVS:
                                NC_000016.10:g.88248720A>T, NC_000016.9:g.88282326A>T
                                16.

                                rs796896714 [Homo sapiens]
                                  GAAACCAGGTGTGGTCTCCAAGCCG[A/G]TGGGTACGGCCAGGGGAGAGAAGGC
                                  Chromosome:
                                  16:88333242
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000016.10:g.88333242G>A, NC_000016.9:g.88366848G>A
                                  17.

                                  rs796877259 [Homo sapiens]
                                    ACAGGCATGCACTCACACACGCACT[-/CG]CACACACCCGGACATGCACTCGCAC
                                    Chromosome:
                                    16:88381090
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000016.10:g.88381090_88381091insCG, NC_000016.9:g.88447498_88447499insCG
                                    18.

                                    rs796875850 [Homo sapiens]
                                      GTTTATGATTTAGGAAAGCAGAAAA[-/A]CTTATGGTCCCCAGGAGATGTGGAA
                                      Chromosome:
                                      16:88244864
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000016.10:g.88244864delA, NC_000016.9:g.88278470delA
                                      19.

                                      rs796875519 [Homo sapiens]
                                        AGGCACCTCTTGCTCTTGTGTCCAC[A/T]CACCCCTGCATGGCAGGTGCTGTCC
                                        Chromosome:
                                        16:88306265
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000016.10:g.88306265A>T, NC_000016.9:g.88339871A>T
                                        20.

                                        rs796859644 [Homo sapiens]
                                          GGCTGGCTGGGGACGAAGAAGGCCG[A/GG]GGGAGAGGCCGGGCAGGGGCTGAGG
                                          Chromosome:
                                          16:88342103
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000016.10:g.88342103_88342104delGGinsA, NC_000016.9:g.88375709_88375710delGGinsA

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center