Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 2993

1.
2.

rs796875897 [Homo sapiens]
    ATGGCAGACTGCATATGCGATGGTG[G/T]TCCCATGAGACTATAACACAGAGCT
    Chromosome:
    13:50965083
    Gene:
    RNASEH2B (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    HGVS:
    NC_000013.10:g.51539219G>T, NC_000013.11:g.50965083G>T, NG_009055.1:g.60328G>T, NM_001142279.2:c.742-4849G>T, XM_005266524.1:c.850-4849G>T, XM_005266525.1:c.823-4849G>T, XM_011535229.1:c.769-4849G>T, XM_017020747.1:c.*36+3569G>T
    6.
    7.

    rs796672876 [Homo sapiens]
      TTACAGCAAACAATTTTAAGACATG[A/G]TGTTTTATCCTCTTGGGTTATGGGA
      Chromosome:
      13:50952899
      Gene:
      RNASEH2B (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by cluster,by frequency
      HGVS:
      NC_000013.10:g.51527035G>A, NC_000013.11:g.50952899G>A, NG_009055.1:g.48144G>A, NM_001142279.2:c.741+3394G>A, NM_024570.3:c.742-1006G>A, XM_005266524.1:c.742-1006G>A, XM_005266525.1:c.742-1006G>A, XM_006719867.3:c.724-1006G>A, XM_011535229.1:c.741+3394G>A, XM_011535233.2:c.334-1006G>A, XM_017020747.1:c.741+3394G>A
      8.
      10.

      rs796562348 [Homo sapiens]
        TAATGTCCAAGTTTGTCACTAGAAA[C/T]CCTGCTGTCTTACCTGTGCCCCAAG
        Chromosome:
        13:50970947
        Gene:
        RNASEH2B (GeneView)
        Functional Consequence:
        downstream variant 500B
        Validated:
        no info
        HGVS:
        NC_000013.10:g.51545083C>T, NC_000013.11:g.50970947C>T, NG_009055.1:g.66192C>T, NM_001142279.2:c.*983C>T, XM_005266524.1:c.*983C>T, XM_005266525.1:c.*983C>T, XM_011535229.1:c.*983C>T, XM_017020747.1:c.*1052C>T
        16.

        rs796410427 [Homo sapiens]
          TTTTTAGTTTTTATGTAGACATATA[C/T]ACATAAACTTTTCCTTTACACAGAT
          Chromosome:
          13:50959338
          Gene:
          RNASEH2B (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          no info
          HGVS:
          NC_000013.10:g.51533474T>C, NC_000013.11:g.50959338T>C, NG_009055.1:g.54583T>C, NM_001142279.2:c.741+9833T>C, XM_005266524.1:c.823-807T>C, XM_005266525.1:c.822+5353T>C, XM_011535229.1:c.742-807T>C, XM_017020747.1:c.742-807T>C
          19.

          Display Settings:

          Format
          Items per page
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center