Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 1479

1.

rs797046070 [Homo sapiens]
    GAATATGGTGGTGAAGAATTCTCCA[C/T]GGAGGACATTTGTCAGGAATGGACA
    Chromosome:
    8:63061334
    Gene:
    TTPA (GeneView)
    Functional Consequence:
    missense
    Clinical significance:
    Uncertain significance
    Validated:
    no info
    HGVS:
    NC_000008.10:g.63973893A>G, NC_000008.11:g.63061334A>G, NG_016123.1:g.29720T>C, NM_000370.3:c.755T>C, NP_000361.1:p.Met252Thr, XM_006716468.3:c.407T>C, XP_006716531.1:p.Met136Thr
    2.

    rs796916366 [Homo sapiens]
      ACATTGGCTGAATGCTATAATGATT[-/AA]AAAAAAAAAAAAGAACATATGAAGT
      Chromosome:
      8:63069292
      Gene:
      TTPA (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000008.10:g.63981851_63981852delAA, NC_000008.11:g.63069292_63069293delAA, NG_016123.1:g.21761_21762delTT, NM_000370.3:c.359-3196_359-3195delTT, XM_006716468.3:c.205-4977_205-4976delTT
      3.

      rs796706457 [Homo sapiens]
        GTTTTAGCCGGGATGGTCTCGATCT[A/C/G]CTGACCTCGTGATCCGCCCGCCTCG
        Chromosome:
        8:63059259
        Gene:
        TTPA (GeneView)
        Functional Consequence:
        downstream variant 500B,utr variant 3 prime
        Validated:
        by frequency
        HGVS:
        NC_000008.10:g.63971818C>A, NC_000008.11:g.63059259C>A, NC_000008.11:g.63059259C>G, NG_016123.1:g.31795G>C, NG_016123.1:g.31795G>T, NM_000370.3:c.*1993G>C, NM_000370.3:c.*1993G>T, XM_006716468.3:c.*1993G>C, XM_006716468.3:c.*1993G>T
        4.

        rs796667802 [Homo sapiens]
          AGACCTGACTGTTAGAAGGAAAACT[-/AACA]AACAGACAGGAATAGCGCCAACATC
          Chromosome:
          8:63078115
          Gene:
          TTPA (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by cluster
          HGVS:
          NC_000008.10:g.63990674_63990677delAACA, NC_000008.11:g.63078115_63078118delAACA, NG_016123.1:g.12936_12939delTGTT, NM_000370.3:c.205-5030_205-5027delTGTT, XM_006716468.3:c.204+7700_204+7703delTGTT
          5.

          rs796592181 [Homo sapiens]
            ACATTTGTTTTGAGTTTAAAGAGAC[-/TTA]TTAATGTGAGACTGCAGTGCAGAGA
            Chromosome:
            8:63074090
            Gene:
            TTPA (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency
            HGVS:
            NC_000008.10:g.63986649_63986651delTTA, NC_000008.11:g.63074090_63074092delTTA, NG_016123.1:g.16962_16964delTAA, NM_000370.3:c.205-1004_205-1002delTAA, XM_006716468.3:c.205-9776_205-9774delTAA
            6.

            rs786204758 [Homo sapiens]
              GCGGCCGCAGCAGCGGCGGCGGGCA[A/C/T]GGCAGAGGCGCGATCCCAGCCCTCG
              Chromosome:
              8:63086020
              Gene:
              TTPA (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              T(germline)/A(germline,unknown)/C(germline,unknown)
              Clinical significance:
              Likely pathogenic
              Validated:
              by cluster
              HGVS:
              NC_000008.10:g.63998579A>G, NC_000008.10:g.63998579A>T, NC_000008.11:g.63086020A>G, NC_000008.11:g.63086020A>T, NG_016123.1:g.5034T>A, NG_016123.1:g.5034T>C, NM_000370.3:c.2T>A, NM_000370.3:c.2T>C, NP_000361.1:p.Met1Lys, NP_000361.1:p.Met1Thr, XM_006716468.3:c.2T>A, XM_006716468.3:c.2T>C, XP_006716531.1:p.Met1Lys, XP_006716531.1:p.Met1Thr
              7.

              rs781777118 [Homo sapiens]
                TGAAAAATAAAATTAAAATTGTCTA[A/C]AAATGGCATACATGGTAATGATTTT
                Chromosome:
                8:63073115
                Gene:
                TTPA (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by frequency
                HGVS:
                NC_000008.10:g.63985674C>A, NC_000008.11:g.63073115C>A, NG_016123.1:g.17939G>T, NM_000370.3:c.205-27G>T, XM_006716468.3:c.205-8799G>T
                8.

                rs781750837 [Homo sapiens]
                  GCCGCAGCGCCGCCAGGCCCGGCTG[A/C]AGCAACGGAGAGTGGTCCGGTAGCG
                  Chromosome:
                  8:63085950
                  Gene:
                  TTPA (GeneView)
                  Functional Consequence:
                  synonymous codon
                  Validated:
                  no info
                  HGVS:
                  NC_000008.10:g.63998509C>A, NC_000008.11:g.63085950C>A, NG_016123.1:g.5104G>T, NM_000370.3:c.72G>T, NP_000361.1:p.Leu24, XM_006716468.3:c.72G>T, XP_006716531.1:p.Leu24
                  9.

                  rs781502890 [Homo sapiens]
                    TTTACTGAAATTGATGCTGCAGTAA[-/CTGT]CTTTGTGTATAGGAGAAGTGGTGGT
                    Chromosome:
                    8:63065175
                    Gene:
                    TTPA (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    HGVS:
                    NC_000008.10:g.63977734_63977737delCTGT, NC_000008.11:g.63065175_63065178delCTGT, NG_016123.1:g.25876_25879delACAG, NM_000370.3:c.552+726_552+729delACAG, XM_006716468.3:c.205-862_205-859delACAG
                    10.

                    rs781346566 [Homo sapiens]
                      TCTTTCATTCATTTAACCAGGTTGG[A/C]TATCACTCATGTATTTTTAGTTAGG
                      Chromosome:
                      8:63061202
                      Gene:
                      TTPA (GeneView)
                      Functional Consequence:
                      utr variant 3 prime
                      Validated:
                      no info
                      HGVS:
                      NC_000008.10:g.63973761A>C, NC_000008.11:g.63061202A>C, NG_016123.1:g.29852T>G, NM_000370.3:c.*50T>G, XM_006716468.3:c.*50T>G
                      11.

                      rs781144364 [Homo sapiens]
                        CTACTTACCAAAGTATGTTGCATTC[C/T]ATAAGCACATTAGCTATTAGGATTA
                        Chromosome:
                        8:63076233
                        Gene:
                        TTPA (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by frequency
                        HGVS:
                        NC_000008.10:g.63988792T>C, NC_000008.11:g.63076233T>C, NG_016123.1:g.14821A>G, NM_000370.3:c.205-3145A>G, XM_006716468.3:c.204+9585A>G
                        12.

                        rs781028846 [Homo sapiens]
                          GAACTCAAGGTCGCATCCCTCTTTC[G/T]GATTCCTATCTTTCCATCACCTTTT
                          Chromosome:
                          8:63085196
                          Gene:
                          TTPA (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          no info
                          HGVS:
                          NC_000008.10:g.63997755T>G, NC_000008.11:g.63085196T>G, NG_016123.1:g.5858A>C, NM_000370.3:c.204+622A>C, XM_006716468.3:c.204+622A>C
                          13.

                          rs780881541 [Homo sapiens]
                            CATGGAAAATTACTGGTTCATTTAT[C/T]AAATGGATGCCACGAACTTTCAATG
                            Chromosome:
                            8:63064281
                            Gene:
                            TTPA (GeneView)
                            Functional Consequence:
                            synonymous codon
                            Validated:
                            by frequency
                            HGVS:
                            NC_000008.10:g.63976840C>T, NC_000008.11:g.63064281C>T, NG_016123.1:g.26773G>A, NM_000370.3:c.588G>A, NP_000361.1:p.Leu196, XM_006716468.3:c.240G>A, XP_006716531.1:p.Leu80
                            14.

                            rs780825444 [Homo sapiens]
                              AATGGAAATGAATCCTTTTGAAAAT[-/A]AAAAAAATCTTAATAACAAAACATA
                              Chromosome:
                              8:63064327
                              Gene:
                              TTPA (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              no info
                              HGVS:
                              NC_000008.10:g.63976886_63976887insA, NC_000008.11:g.63064327_63064328insA, NG_016123.1:g.26726_26727insT, NM_000370.3:c.553-12_553-11insT, XM_006716468.3:c.205-12_205-11insT
                              15.

                              rs780747265 [Homo sapiens]
                                CAACAGGCACATTGTAGGTCCTAAT[A/G]TCTTCATTCTACTCTACACGGTGCA
                                Chromosome:
                                8:63074594
                                Gene:
                                TTPA (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                no info
                                HGVS:
                                NC_000008.10:g.63987153A>G, NC_000008.11:g.63074594A>G, NG_016123.1:g.16460T>C, NM_000370.3:c.205-1506T>C, XM_006716468.3:c.205-10278T>C
                                16.

                                rs780631720 [Homo sapiens]
                                  GTTTTGTGTTCAAGGCATTAGATGA[C/T]GCCAATGTTTGTCTAAATAGATGCT
                                  Chromosome:
                                  8:63063213
                                  Gene:
                                  TTPA (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by cluster
                                  HGVS:
                                  NC_000008.10:g.63975772T>C, NC_000008.11:g.63063213T>C, NG_016123.1:g.27841A>G, NM_000370.3:c.663+993A>G, XM_006716468.3:c.315+993A>G
                                  17.

                                  rs780550333 [Homo sapiens]
                                    AGAGAGGGGAGATAGATGTAATGAA[-/GGAG]GGAGAGTTTTGTGGAACGAATGAGG
                                    Chromosome:
                                    8:63068620
                                    Gene:
                                    TTPA (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by cluster,by frequency
                                    HGVS:
                                    NC_000008.10:g.63981179_63981182delGGAG, NC_000008.11:g.63068620_63068623delGGAG, NG_016123.1:g.22431_22434delCTCC, NM_000370.3:c.359-2526_359-2523delCTCC, XM_006716468.3:c.205-4307_205-4304delCTCC
                                    18.

                                    rs780460659 [Homo sapiens]
                                      ATCAATATACACCTACCAAGACTTA[C/T]GTGACATTTTATTGTTCCATTGATA
                                      Chromosome:
                                      8:63065564
                                      Gene:
                                      TTPA (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by cluster,by frequency
                                      HGVS:
                                      NC_000008.10:g.63978123T>C, NC_000008.11:g.63065564T>C, NG_016123.1:g.25490A>G, NM_000370.3:c.552+340A>G, XM_006716468.3:c.205-1248A>G
                                      19.

                                      rs780298302 [Homo sapiens]
                                        AGACAGCATGGAAAATTACTGGTTC[A/G]TTTATCAAATGGATGCCACGAACTT
                                        Chromosome:
                                        8:63064275
                                        Gene:
                                        TTPA (GeneView)
                                        Functional Consequence:
                                        synonymous codon
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000008.10:g.63976834A>G, NC_000008.11:g.63064275A>G, NG_016123.1:g.26779T>C, NM_000370.3:c.594T>C, NP_000361.1:p.Asn198, XM_006716468.3:c.246T>C, XP_006716531.1:p.Asn82
                                        20.

                                        rs780199989 [Homo sapiens]
                                          GACGCCAGCTTCCCGGGCCCGGCGC[C/T]GCAGCGCCGCCAGGCCCGGCTGCAG
                                          Chromosome:
                                          8:63085927
                                          Gene:
                                          TTPA (GeneView)
                                          Functional Consequence:
                                          missense
                                          Validated:
                                          by frequency
                                          HGVS:
                                          NC_000008.10:g.63998486C>T, NC_000008.11:g.63085927C>T, NG_016123.1:g.5127G>A, NM_000370.3:c.95G>A, NP_000361.1:p.Arg32Gln, XM_006716468.3:c.95G>A, XP_006716531.1:p.Arg32Gln

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center