Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 2422

1.

rs796740761 [Homo sapiens]
    GTAGAAAAAAAACAAACAAACAAAC[-/AG]AAAAAAAAACCAAAAAAAACCACCC
    Chromosome:
    Y:651411
    Gene:
    SHOX (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster
    HGVS:
    NC_000023.10:g.612146_612147delAG, NC_000023.11:g.651411_651412delAG, NC_000024.10:g.651411_651412delAG, NC_000024.9:g.562146_562147delAG, NG_009385.2:g.32068_32069delAG, NM_006883.2:c.634-7374_634-7373delAG, XR_247282.1:n.4395_4396delAG, XR_247322.1:n.4395_4396delAG
    2.

    rs796413961 [Homo sapiens]
      TTTGTTATTTATTTTTTTTTCCTTG[G/T]TCGGACGTTCATAAATATGTACTAT
      Chromosome:
      Y:651121
      Gene:
      SHOX (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000023.10:g.611856G>T, NC_000023.11:g.651121G>T, NC_000024.10:g.651121G>T, NC_000024.9:g.561856G>T, NG_009385.2:g.31778G>T, NM_006883.2:c.634-7664G>T, XR_247282.1:n.4105G>T, XR_247322.1:n.4105G>T
      3.

      rs781781837 [Homo sapiens]
        ACGGGCAGACCAAGCTGAAACAGAG[A/G]CGCAGCCGCACCAACTTCACGCTGG
        Chromosome:
        Y:634694
        Gene:
        SHOX (GeneView)
        Functional Consequence:
        synonymous codon
        Validated:
        no info
        HGVS:
        NC_000023.10:g.595429G>A, NC_000023.11:g.634694G>A, NC_000024.10:g.634694G>A, NC_000024.9:g.545429G>A, NG_009385.2:g.15351G>A, NM_000451.3:c.354G>A, NM_006883.2:c.354G>A, NP_000442.1:p.Arg118, NP_006874.1:p.Arg118, XR_247282.1:n.1045G>A, XR_247322.1:n.1045G>A
        5.

        rs781700346 [Homo sapiens]
          TGACTCCCCCAGCAAATACAGACAG[C/G]TCACCAACTACTGGAGATGAGAAAG
          Chromosome:
          Y:633932
          Gene:
          SHOX (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by 1000G,by frequency
          Global MAF:
          C=0.0004/2
          HGVS:
          NC_000023.10:g.594667G>C, NC_000023.11:g.633932G>C, NC_000024.10:g.633932G>C, NC_000024.9:g.544667G>C, NG_009385.2:g.14589G>C, NM_000451.3:c.278-686G>C, NM_006883.2:c.278-686G>C, XR_247282.1:n.969-686G>C, XR_247322.1:n.969-686G>C
          6.

          rs781699409 [Homo sapiens]
            CCAGCCTGGCCAACATGGTGAAACC[A/G]CGTCTCTACTAAAATACAAAATTAG
            Chromosome:
            Y:640405
            Gene:
            SHOX (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster
            Global MAF:
            A=0.0002/1
            HGVS:
            NC_000023.10:g.601140G>A, NC_000023.11:g.640405G>A, NC_000024.10:g.640405G>A, NC_000024.9:g.551140G>A, NG_009385.2:g.21062G>A, NM_000451.3:c.487-416G>A, NM_006883.2:c.487-416G>A, XR_247282.1:n.1178-416G>A, XR_247322.1:n.1178-416G>A
            7.

            rs781656634 [Homo sapiens]
              GGCTCAAGGCGCGGAAGCACGCGGA[A/G]GCCCTGGGGCTCTGACCCGCCGCGC
              Chromosome:
              Y:644621
              Gene:
              SHOX (GeneView)
              Functional Consequence:
              intron variant,synonymous codon
              Clinical significance:
              Uncertain significance
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              A=0.0016/8
              HGVS:
              NC_000023.10:g.605356G>A, NC_000023.11:g.644621G>A, NC_000024.10:g.644621G>A, NC_000024.9:g.555356G>A, NG_009385.2:g.25278G>A, NM_000451.3:c.864G>A, NM_006883.2:c.633+3534G>A, NP_000442.1:p.Glu288, XR_247282.1:n.1555G>A, XR_247322.1:n.1555G>A
              8.

              rs781635351 [Homo sapiens]
                AGGTGGTGACCGCGCTGGGGACGCC[A/T]GGACGCGAATGAACCTCCGGGGCGC
                Chromosome:
                Y:624552
                Gene:
                SHOX (GeneView)
                Functional Consequence:
                utr variant 5 prime
                Validated:
                by 1000G,by frequency
                Global MAF:
                T=0.0016/8
                HGVS:
                NC_000023.10:g.585287A>T, NC_000023.11:g.624552A>T, NC_000024.10:g.624552A>T, NC_000024.9:g.535287A>T, NG_009385.2:g.5209A>T, NM_000451.3:c.-483A>T, NM_006883.2:c.-483A>T, XR_247282.1:n.209A>T, XR_247322.1:n.209A>T
                9.
                10.

                rs781554391 [Homo sapiens]
                  TCTGTATCTCTGTCTGTCTCTGTCT[C/T]TCTTTCTCTCCTCTCTCTGTGTCTC
                  Chromosome:
                  Y:625784
                  Gene:
                  SHOX (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by 1000G
                  Global MAF:
                  T=0.0002/1
                  HGVS:
                  NC_000023.10:g.586519C>T, NC_000023.11:g.625784C>T, NC_000024.10:g.625784C>T, NC_000024.9:g.536519C>T, NG_009385.2:g.6441C>T, NM_000451.3:c.-433+1182C>T, NM_006883.2:c.-433+1182C>T, XR_247282.1:n.259+1182C>T, XR_247322.1:n.259+1182C>T
                  11.

                  rs781552450 [Homo sapiens]
                    CGTCTCTGCGTGCGTCCGCCGCGGA[A/G]CCCGGAGACCAGTAATTGCACCAGA
                    Chromosome:
                    Y:630699
                    Gene:
                    SHOX (GeneView)
                    Functional Consequence:
                    utr variant 5 prime
                    Validated:
                    by 1000G
                    Global MAF:
                    A=0.0002/1
                    HGVS:
                    NC_000023.10:g.591434G>A, NC_000023.11:g.630699G>A, NC_000024.10:g.630699G>A, NC_000024.9:g.541434G>A, NG_009385.2:g.11356G>A, NM_000451.3:c.-199G>A, NM_006883.2:c.-199G>A, XR_247282.1:n.493G>A, XR_247322.1:n.493G>A
                    12.

                    rs781480718 [Homo sapiens]
                      CAGGCGTGAGCCACTGCACTTGGCC[-/T]TTTTTTTTTTTTTAGATGGAGTTTT
                      Chromosome:
                      Y:658769
                      Gene:
                      SHOX (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by frequency
                      HGVS:
                      NC_000023.10:g.619504_619505insT, NC_000023.11:g.658769_658770insT, NC_000024.10:g.658769_658770insT, NC_000024.9:g.569504_569505insT, NG_009385.2:g.39426_39427insT, NM_006883.2:c.634-16_634-15insT
                      13.

                      rs781453927 [Homo sapiens]
                        GCAACCTCCACCTCCTGGGTTCAAG[C/G]AATCCTCCTGCCTCAGCCTCCCGAG
                        Chromosome:
                        Y:655210
                        Gene:
                        SHOX (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G
                        Global MAF:
                        G=0.0002/1
                        HGVS:
                        NC_000023.10:g.615945C>G, NC_000023.11:g.655210C>G, NC_000024.10:g.655210C>G, NC_000024.9:g.565945C>G, NG_009385.2:g.35867C>G, NM_006883.2:c.634-3575C>G
                        14.

                        rs781452894 [Homo sapiens]
                          ACTTTTTCTTCCTCTGAAGATCCCT[A/G]GGGACCTGCTGCTCCCTTCCCCTTT
                          Chromosome:
                          Y:641120
                          Gene:
                          SHOX (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by frequency
                          HGVS:
                          NC_000023.10:g.601855A>G, NC_000023.11:g.641120A>G, NC_000024.10:g.641120A>G, NC_000024.9:g.551855A>G, NG_009385.2:g.21777A>G, NM_000451.3:c.633+33A>G, NM_006883.2:c.633+33A>G, XR_247282.1:n.1324+33A>G, XR_247322.1:n.1324+33A>G
                          15.

                          rs781443509 [Homo sapiens]
                            GTCTCTCTTTCTCTCTCTCCATCTC[-/T]CTCTGTCTCTCCCTGTGTTTCTCTC
                            Chromosome:
                            Y:628830
                            Gene:
                            SHOX (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by frequency
                            Global MAF:
                            -=0.0014/7
                            HGVS:
                            NC_000023.10:g.589565delT, NC_000023.11:g.628830delT, NC_000024.10:g.628830delT, NC_000024.9:g.539565delT, NG_009385.2:g.9487delT, NM_000451.3:c.-432-1636delT, NM_006883.2:c.-432-1636delT, XR_247282.1:n.260-1636delT, XR_247322.1:n.260-1636delT
                            16.

                            rs781401919 [Homo sapiens]
                              TCTCCGACACCTCCCCAGTTGCCTG[C/G]AGTCTAAACCGTCCGTTGTCTGTAC
                              Chromosome:
                              Y:652597
                              Gene:
                              SHOX (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G
                              Global MAF:
                              C=0.0002/1
                              HGVS:
                              NC_000023.10:g.613332G>C, NC_000023.11:g.652597G>C, NC_000024.10:g.652597G>C, NC_000024.9:g.563332G>C, NG_009385.2:g.33254G>C, NM_006883.2:c.634-6188G>C
                              17.

                              rs781264148 [Homo sapiens]
                                GGAAATCAAAAGGAAATCGCATTAC[A/G]GCATTTGGGAAAGAAAGCGGGGAGT
                                Chromosome:
                                Y:638082
                                Gene:
                                SHOX (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster
                                Global MAF:
                                A=0.0002/1
                                HGVS:
                                NC_000023.10:g.598817G>A, NC_000023.11:g.638082G>A, NC_000024.10:g.638082G>A, NC_000024.9:g.548817G>A, NG_009385.2:g.18739G>A, NM_000451.3:c.487-2739G>A, NM_006883.2:c.487-2739G>A, XR_247282.1:n.1178-2739G>A, XR_247322.1:n.1178-2739G>A
                                18.

                                rs781246972 [Homo sapiens]
                                  ATCTTGTCACTGAGCTGAACTGTAG[A/C]TCCATTTGGACCCGTCTCATTTGTA
                                  Chromosome:
                                  Y:646607
                                  Gene:
                                  SHOX (GeneView)
                                  Functional Consequence:
                                  intron variant,utr variant 3 prime
                                  Validated:
                                  by 1000G
                                  Global MAF:
                                  C=0.0002/1
                                  HGVS:
                                  NC_000023.10:g.607342A>C, NC_000023.11:g.646607A>C, NC_000024.10:g.646607A>C, NC_000024.9:g.557342A>C, NG_009385.2:g.27264A>C, NM_000451.3:c.*1971A>C, NM_006883.2:c.633+5520A>C, XR_247282.1:n.3541A>C, XR_247322.1:n.3541A>C
                                  19.
                                  20.

                                  rs781195996 [Homo sapiens]
                                    TCTTTTTCTTTCTTTCTCTCTTTCT[C/T]TCTTTTCTTTCTTTCTGTTTCTTTC
                                    Chromosome:
                                    Y:648940
                                    Gene:
                                    SHOX (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by cluster,by frequency
                                    Global MAF:
                                    C=0.0002/1
                                    HGVS:
                                    NC_000023.10:g.609675T>C, NC_000023.11:g.648940T>C, NC_000024.10:g.648940T>C, NC_000024.9:g.559675T>C, NG_009385.2:g.29597T>C, NM_006883.2:c.633+7853T>C, XR_247282.1:n.3742-1818T>C, XR_247322.1:n.3742-1818T>C

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center