Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from

Items: 1 to 20 of 1547

1.

rs786204995 [Homo sapiens]
    TAGAATATGTTTGTGTTCTTAAAGG[C/T]AAGTCATGCGCACTCTGCTGCTCTT
    Chromosome:
    X:18645960
    Gene:
    CDKL5 (GeneView) RS1 (GeneView)
    Functional Consequence:
    intron variant
    Allele Origin:
    T(unknown)/C(germline,unknown)
    Clinical significance:
    Uncertain significance
    Validated:
    no info
    HGVS:
    NC_000023.10:g.18664080C>T, NC_000023.11:g.18645960C>T, NG_008475.1:g.225356C>T, NG_008659.3:g.36489G>A, NM_000330.3:c.326+1231G>A, NM_001037343.1:c.2714-47C>T, NM_003159.2:c.2714-47C>T
    2.

    rs786204952 [Homo sapiens]
      TTTCTGAAAATATCTGTGTTGTTAA[AT/GA]TCAAAAACCAGGGCCAGGTGCAGTG
      Chromosome:
      X:18653674
      Gene:
      CDKL5 (GeneView) RS1 (GeneView)
      Functional Consequence:
      downstream variant 500B,intron variant
      Allele Origin:
      T(unknown)/(germline,unknown)
      Clinical significance:
      Benign
      Validated:
      no info
      HGVS:
      NC_000023.10:g.18671794_18671795delGAinsAT, NC_000023.11:g.18653674_18653675delGAinsAT, NG_008475.1:g.233070_233071delGAinsAT, NG_008659.3:g.28774_28775delTCinsAT, NM_000330.3:c.184+2978_184+2979delTCinsAT, NM_001037343.1:c.*130_*131delGAinsAT, NM_003159.2:c.*130_*131delGAinsAT
      3.

      rs781640757 [Homo sapiens]
        GGGACTGCAGGCATATGCCACCGTG[-/C]CCCCCCCCATCTAGAGATGGGGTTT
        Chromosome:
        X:18654312
        Gene:
        RS1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by frequency
        Global MAF:
        C=0.0132/50
        HGVS:
        NC_000023.10:g.18672432_18672433insC, NC_000023.11:g.18654312_18654313insC, NG_008475.1:g.233708_233709insC, NG_008659.3:g.28136_28137insG, NM_000330.3:c.184+2340_184+2341insG
        4.

        rs781598838 [Homo sapiens]
          GTGTTGTCCAGCACTGTATTAGCGC[A/G]AGTCTAGTCACTTGCCTTGGCATTT
          Chromosome:
          X:18640664
          Gene:
          CDKL5 (GeneView) RS1 (GeneView)
          Functional Consequence:
          intron variant,utr variant 3 prime
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          A=0.0003/1
          HGVS:
          NC_000023.10:g.18658784G>A, NC_000023.11:g.18640664G>A, NG_008475.1:g.220060G>A, NG_008659.3:g.41785C>T, NM_000330.3:c.*1340C>T, NM_001037343.1:c.2714-5343G>A, NM_003159.2:c.2714-5343G>A
          5.

          rs781589263 [Homo sapiens]
            TCCCCCTCTTTCTTCCCACACCTCA[A/C]CTACTCTCCCTGGATTGCTCTGGCC
            Chromosome:
            X:18645657
            Gene:
            CDKL5 (GeneView) RS1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            C=0.0016/6
            HGVS:
            NC_000023.10:g.18663777A>C, NC_000023.11:g.18645657A>C, NG_008475.1:g.225053A>C, NG_008659.3:g.36792T>G, NM_000330.3:c.327-1032T>G, NM_001037343.1:c.2714-350A>C, NM_003159.2:c.2714-350A>C
            6.

            rs781558063 [Homo sapiens]
              ATGGAGTTTCACTCTTGTTGCCCAG[C/G/T]CTGGAGTACAATGGCGCGATCTCGG
              Chromosome:
              X:18658501
              Gene:
              RS1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by 1000G,by cluster
              Global MAF:
              C=0.0003/1
              HGVS:
              NC_000023.10:g.18676621G>C, NC_000023.10:g.18676621G>T, NC_000023.11:g.18658501G>C, NC_000023.11:g.18658501G>T, NG_008659.3:g.23948C>A, NG_008659.3:g.23948C>G, NM_000330.3:c.53-836C>A, NM_000330.3:c.53-836C>G
              7.

              rs781544130 [Homo sapiens]
                CGCTTGAACCCGGGAGGCAGAGGTT[G/T]CAGTGAGCCGAGGTGGTGCCTGCAG
                Chromosome:
                X:18648141
                Gene:
                CDKL5 (GeneView) RS1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster
                Global MAF:
                G=0.0003/1
                HGVS:
                NC_000023.10:g.18666261T>G, NC_000023.11:g.18648141T>G, NG_008475.1:g.227537T>G, NG_008659.3:g.34308A>C, NM_000330.3:c.185-809A>C, NM_001037343.1:c.2797+2051T>G, NM_003159.2:c.2797+2051T>G
                8.

                rs781477275 [Homo sapiens]
                  AGGTAGAGTCTGGGCCCCGCATGCC[A/T]TCAAGCTGCCATAACGACCCTAGAC
                  Chromosome:
                  X:18646114
                  Gene:
                  CDKL5 (GeneView) RS1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  no info
                  HGVS:
                  NC_000023.10:g.18664234A>T, NC_000023.11:g.18646114A>T, NG_008475.1:g.225510A>T, NG_008659.3:g.36335T>A, NM_000330.3:c.326+1077T>A, NM_001037343.1:c.2797+24A>T, NM_003159.2:c.2797+24A>T
                  9.

                  rs781435432 [Homo sapiens]
                    TCGTCCAATCTCCAGTCCTGCTCCC[C/T]ATCCAGTACTCCAGGTCCGAGGCAC
                    Chromosome:
                    X:18650502
                    Gene:
                    CDKL5 (GeneView) RS1 (GeneView)
                    Functional Consequence:
                    intron variant,missense
                    Validated:
                    by frequency
                    HGVS:
                    NC_000023.10:g.18668622T>C, NC_000023.11:g.18650502T>C, NG_008475.1:g.229898T>C, NG_008659.3:g.31947A>G, NM_000330.3:c.185-3170A>G, NM_001037343.1:c.2890T>C, NM_003159.2:c.2890T>C, NP_001032420.1:p.Tyr964His, NP_003150.1:p.Tyr964His
                    10.

                    rs781395509 [Homo sapiens]
                      TTAAATTAATTAAAATTGGCCGGGC[A/G]GGGTAGCTCATGCCTGTAATCCTAG
                      Chromosome:
                      X:18659200
                      Gene:
                      RS1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G
                      Global MAF:
                      A=0.0003/1
                      HGVS:
                      NC_000023.10:g.18677320G>A, NC_000023.11:g.18659200G>A, NG_008659.3:g.23249C>T, NM_000330.3:c.53-1535C>T
                      11.

                      rs781331738 [Homo sapiens]
                        GGGGTGTTCCCAATGACTGTTCCAT[C/G]CCAAGGACAGGGGATACTCACCTGG
                        Chromosome:
                        X:18656631
                        Gene:
                        RS1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        NC_000023.10:g.18674751C>G, NC_000023.11:g.18656631C>G, NG_008659.3:g.25818G>C, NM_000330.3:c.184+22G>C
                        12.

                        rs781291294 [Homo sapiens]
                          TCCCTGTGTTCATGAGGGTGGAAGC[A/C]CAGATCCGCCTTGAAGGTAAGAACT
                          Chromosome:
                          X:18641360
                          Gene:
                          CDKL5 (GeneView) RS1 (GeneView)
                          Functional Consequence:
                          intron variant,utr variant 3 prime
                          Validated:
                          by 1000G,by cluster
                          Global MAF:
                          A=0.0003/1
                          HGVS:
                          NC_000023.10:g.18659480C>A, NC_000023.11:g.18641360C>A, NG_008475.1:g.220756C>A, NG_008659.3:g.41089G>T, NM_000330.3:c.*644G>T, NM_001037343.1:c.2714-4647C>A, NM_003159.2:c.2714-4647C>A
                          13.

                          rs781289149 [Homo sapiens]
                            ACAAAAATTAGCCGAGCGCAGTGGT[G/T]GGCACCTGTAATCCCAGCTACTTGG
                            Chromosome:
                            X:18652538
                            Gene:
                            CDKL5 (GeneView) RS1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by frequency
                            Global MAF:
                            G=0.0008/3
                            HGVS:
                            NC_000023.10:g.18670658T>G, NC_000023.11:g.18652538T>G, NG_008475.1:g.231934T>G, NG_008659.3:g.29911A>C, NM_000330.3:c.184+4115A>C, NM_001037343.1:c.2981-894T>G, NM_003159.2:c.2981-894T>G
                            14.

                            rs781283628 [Homo sapiens]
                              GACAGTTAACACAAAGCTGTGCATT[A/G]CTGTGTTACTTTTAACAACAACAAA
                              Chromosome:
                              X:18672883
                              Gene:
                              RS1 (GeneView)
                              Functional Consequence:
                              upstream variant 2KB
                              Validated:
                              by 1000G,by cluster,by frequency
                              Global MAF:
                              A=0.0008/3
                              HGVS:
                              NC_000023.10:g.18691003G>A, NC_000023.11:g.18672883G>A, NG_008659.3:g.9566C>T, NM_000330.3:c.-815C>T
                              15.

                              rs781282917 [Homo sapiens]
                                TTGCGTGACATCTTCCCCTCGTCCT[C/G/T]GGCCAAAGCTCTACCTTACTGAACT
                                Chromosome:
                                X:18672083
                                Gene:
                                RS1 (GeneView)
                                Functional Consequence:
                                utr variant 5 prime
                                Validated:
                                by frequency
                                HGVS:
                                NC_000023.10:g.18690203C>G, NC_000023.10:g.18690203C>T, NC_000023.11:g.18672083C>G, NC_000023.11:g.18672083C>T, NG_008659.3:g.10366G>A, NG_008659.3:g.10366G>C, NM_000330.3:c.-15G>A, NM_000330.3:c.-15G>C
                                16.

                                rs781240357 [Homo sapiens]
                                  CTTGAAACCCGGGTTGCAGTGAGCC[A/G]ATATTGCACCACTGCACTCCAGTCT
                                  Chromosome:
                                  X:18659415
                                  Gene:
                                  RS1 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000023.10:g.18677535G>A, NC_000023.11:g.18659415G>A, NG_008659.3:g.23034C>T, NM_000330.3:c.53-1750C>T
                                  17.

                                  rs781236721 [Homo sapiens]
                                    AAAACTCCATTTCCCAGACTTGTTT[-/G]TTTTTTTTTTCTTTTGAGACTGGCT
                                    Chromosome:
                                    X:18660263
                                    Gene:
                                    RS1 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by frequency
                                    Global MAF:
                                    G=0.0050/19
                                    HGVS:
                                    NC_000023.10:g.18678383_18678384insG, NC_000023.11:g.18660263_18660264insG, NG_008659.3:g.22185_22186insC, NM_000330.3:c.53-2599_53-2598insC
                                    18.

                                    rs781205609 [Homo sapiens]
                                      AGGCAGGGCAGAAAAGTCACGGTCA[A/C]AGGCAACTGTGGTTGCCCCCACGGA
                                      Chromosome:
                                      X:18656800
                                      Gene:
                                      RS1 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by frequency
                                      HGVS:
                                      NC_000023.10:g.18674920A>C, NC_000023.11:g.18656800A>C, NG_008659.3:g.25649T>G, NM_000330.3:c.79-42T>G
                                      19.

                                      rs781143233 [Homo sapiens]
                                        CTCCCAAAGTGCTGGGATTACAGGC[A/G]TGGGCCACTGTGCCCGTCCTCCCAT
                                        Chromosome:
                                        X:18656272
                                        Gene:
                                        RS1 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G,by cluster
                                        Global MAF:
                                        A=0.0003/1
                                        HGVS:
                                        NC_000023.10:g.18674392G>A, NC_000023.11:g.18656272G>A, NG_008659.3:g.26177C>T, NM_000330.3:c.184+381C>T
                                        20.

                                        rs781088273 [Homo sapiens]
                                          TCCACAAAGCCACAAATATTTCCTC[C/T]CTCCTCCTTTACAAAGTTTGCTGGC
                                          Chromosome:
                                          X:18655429
                                          Gene:
                                          RS1 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          by 1000G,by cluster,by frequency
                                          Global MAF:
                                          C=0.0008/3
                                          HGVS:
                                          NC_000023.10:g.18673549T>C, NC_000023.11:g.18655429T>C, NG_008475.1:g.234825T>C, NG_008659.3:g.27020A>G, NM_000330.3:c.184+1224A>G

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center