Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 3126

1.

rs797044448 [Homo sapiens]
    GATCTTCTTGGACCCGGAGAAGAGG[A/G]TAAGAGGCAGTGGGCGGGCCAAGGA
    Chromosome:
    1:11952736
    Gene:
    PLOD1 (GeneView)
    Functional Consequence:
    splice donor variant
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000001.10:g.12012793G>A, NC_000001.11:g.11952736G>A, NG_008159.1:g.23048G>A, NM_000302.3:c.579+1G>A, NM_001316320.1:c.720+1G>A, XM_005263474.1:c.720+1G>A
    2.

    rs797044447 [Homo sapiens]
      CCTTGACTGAGTCCCTGCCCTCCCC[-/A]GCCCTGCCCGGATGTCTATTGGTTC
      Chromosome:
      1:11966985
      Gene:
      PLOD1 (GeneView)
      Functional Consequence:
      splice acceptor variant
      Clinical significance:
      Pathogenic
      Validated:
      no info
      HGVS:
      NC_000001.10:g.12027042delA, NC_000001.11:g.11966985delA, NG_008159.1:g.37297delA, NM_000302.3:c.1651-2delA, NM_001316320.1:c.1792-2delA, XM_005263474.1:c.1792-2delA
      3.
      4.

      rs796969636 [Homo sapiens]
        CATCACAACTGGCTAATTTTTTGTA[-/TT]TTTTTTTTTTTTTTTGAGACGGAGT
        Chromosome:
        1:11959619
        Gene:
        PLOD1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        HGVS:
        NC_000001.10:g.12019676_12019677delTT, NC_000001.11:g.11959619_11959620delTT, NG_008159.1:g.29931_29932delTT, NM_000302.3:c.975+972_975+973delTT, NM_001316320.1:c.1116+972_1116+973delTT, XM_005263474.1:c.1116+972_1116+973delTT
        5.

        rs796963826 [Homo sapiens]
          TTCTTTTGATTTTTGTTTTCTTTTT[C/T]TTTTTTTTTTTTTTGAGATGGAGTC
          Chromosome:
          1:11962280
          Gene:
          PLOD1 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          no info
          HGVS:
          NC_000001.10:g.12022337T>C, NC_000001.11:g.11962280T>C, NG_008159.1:g.32592T>C, NM_000302.3:c.1098-1252T>C, NM_001316320.1:c.1239-1252T>C, XM_005263474.1:c.1239-1252T>C
          6.

          rs796962441 [Homo sapiens]
            CTTTGAGTTGCCTTGACCGTAAGCT[A/G]CTAGGTTTTCAGTTCCTGGTTTGCT
            Chromosome:
            1:11967332
            Gene:
            PLOD1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            no info
            HGVS:
            NC_000001.10:g.12027389A>G, NC_000001.11:g.11967332A>G, NG_008159.1:g.37644A>G, NM_000302.3:c.1755+241A>G, NM_001316320.1:c.1896+241A>G, XM_005263474.1:c.1896+241A>G
            7.

            rs796866137 [Homo sapiens]
              AGGTTGGTCACAGTTAGTAAAGAGT[A/G]GAGGTGATGTCTGCCCAGGGCTGCC
              Chromosome:
              1:11974136
              Gene:
              PLOD1 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              HGVS:
              NC_000001.10:g.12034193G>A, NC_000001.11:g.11974136G>A, NG_008159.1:g.44448G>A, NM_000302.3:c.2029-517G>A, NM_001316320.1:c.2170-517G>A, XM_005263474.1:c.2170-517G>A
              8.

              rs796762268 [Homo sapiens]
                TCTCCTAAGTAGCTGGGATTATTAT[-/TA]TTATTATTATTATTATTTTTGAGAT
                Chromosome:
                1:11941476
                Gene:
                PLOD1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                no info
                HGVS:
                NC_000001.10:g.12001533_12001534delTA, NC_000001.11:g.11941476_11941477delTA, NG_008159.1:g.11788_11789delTA, NM_000302.3:c.77-6500_77-6499delTA, NM_001316320.1:c.77-3046_77-3045delTA, XM_005263474.1:c.77-3046_77-3045delTA
                9.

                rs796711114 [Homo sapiens]
                  TGTGTGTGTATATATATATATATAT[-/AA]AAAGAAATATATATAGATTTTATTT
                  Chromosome:
                  1:11967615
                  Gene:
                  PLOD1 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  no info
                  HGVS:
                  NC_000001.10:g.12027672_12027673delAA, NC_000001.11:g.11967615_11967616delAA, NG_008159.1:g.37927_37928delAA, NM_000302.3:c.1755+524_1755+525delAA, NM_001316320.1:c.1896+524_1896+525delAA, XM_005263474.1:c.1896+524_1896+525delAA
                  10.

                  rs796670783 [Homo sapiens]
                    TGAATGTTTTACTTTATTATATATA[-/T]AAAAAAAAAGGCCGAGAGCAGTGGC
                    Chromosome:
                    1:11961092
                    Gene:
                    PLOD1 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster
                    HGVS:
                    NC_000001.10:g.12021149_12021150insT, NC_000001.11:g.11961092_11961093insT, NG_008159.1:g.31404_31405insT, NM_000302.3:c.1097+325_1097+326insT, NM_001316320.1:c.1238+325_1238+326insT, XM_005263474.1:c.1238+325_1238+326insT
                    11.

                    rs796668443 [Homo sapiens]
                      AAAATTAGCCAGGTGTGGTGGCAGG[C/T]GCCTGTAGTCCCAGCTACTCGGGAG
                      Chromosome:
                      1:11951791
                      Gene:
                      PLOD1 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by cluster
                      HGVS:
                      NC_000001.10:g.12011848C>T, NC_000001.11:g.11951791C>T, NG_008159.1:g.22103C>T, NM_000302.3:c.467-832C>T, NM_001316320.1:c.608-832C>T, XM_005263474.1:c.608-832C>T
                      12.

                      rs796658588 [Homo sapiens]
                        AGCTCTTGATCACTTACTCTTTGGG[-/T]TTTTTTTTTTTTTGAGACAGTCTCA
                        Chromosome:
                        1:11974201
                        Gene:
                        PLOD1 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        NC_000001.10:g.12034258_12034259insT, NC_000001.11:g.11974201_11974202insT, NG_008159.1:g.44513_44514insT, NM_000302.3:c.2029-452_2029-451insT, NM_001316320.1:c.2170-452_2170-451insT, XM_005263474.1:c.2170-452_2170-451insT
                        13.

                        rs796591080 [Homo sapiens]
                          AATTTTTTTTTTTTTTTTTTTTTTG[-/A]GACGGAGTTTTGCTCGTCACCCAGG
                          Chromosome:
                          1:11969044
                          Gene:
                          PLOD1 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          no info
                          HGVS:
                          NC_000001.10:g.12029101delA, NC_000001.11:g.11969044delA, NG_008159.1:g.39356delA, NM_000302.3:c.1756-1626delA, NM_001316320.1:c.1897-1626delA, XM_005263474.1:c.1897-1626delA
                          14.

                          rs796539774 [Homo sapiens]
                            TTTTTTTTTTTTAAGTTTTCATTTT[C/T]TTTTTTTTTTTTTCTTTGAGACAGA
                            Chromosome:
                            1:11937953
                            Gene:
                            PLOD1 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by cluster
                            HGVS:
                            NC_000001.10:g.11998010C>T, NC_000001.11:g.11937953C>T, NG_008159.1:g.8265C>T, NM_000302.3:c.76+3098C>T, NM_001316320.1:c.76+3098C>T, XM_005263474.1:c.76+3098C>T
                            15.

                            rs796524419 [Homo sapiens]
                              CTTTCTTCCCTTCCTTCCTTCCTTC[-/CTCTCT]CTCTCTCTCTCTCTTTCTTTCTCTC
                              Chromosome:
                              1:11972210
                              Gene:
                              PLOD1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              no info
                              HGVS:
                              NC_000001.10:g.12032267_12032272delCTCTCT, NC_000001.11:g.11972210_11972215delCTCTCT, NG_008159.1:g.42522_42527delCTCTCT, NM_000302.3:c.1903-662_1903-657delCTCTCT, NM_001316320.1:c.2044-662_2044-657delCTCTCT, XM_005263474.1:c.2044-662_2044-657delCTCTCT
                              16.

                              rs796458484 [Homo sapiens]
                              • Suspected
                              TAATACTTTCTCACAGAGATGTTGT[C/T]AGGATTAAATTGATTAATATATGTA
                              Chromosome:
                              1:11953838
                              Gene:
                              PLOD1 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              no info
                              HGVS:
                              NC_000001.10:g.12013895C>T, NC_000001.11:g.11953838C>T, NG_008159.1:g.24150C>T, NM_000302.3:c.580-992C>T, NM_001316320.1:c.721-992C>T, XM_005263474.1:c.721-992C>T
                              17.
                              18.

                              rs796438993 [Homo sapiens]
                                TTTTTTTTTTTAAGTTTTCATTTTC[-/T]TTTTTTTTTTTTCTTTGAGACAGAG
                                Chromosome:
                                1:11937954
                                Gene:
                                PLOD1 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                no info
                                HGVS:
                                NC_000001.10:g.11998011delT, NC_000001.11:g.11937954delT, NG_008159.1:g.8266delT, NM_000302.3:c.76+3099delT, NM_001316320.1:c.76+3099delT, XM_005263474.1:c.76+3099delT
                                19.

                                rs796410424 [Homo sapiens]
                                  AATCCCAGCTCACCATTTACTAGCT[A/G]TGTGACATTGGGCAACTTCTCTGTC
                                  Chromosome:
                                  1:11953453
                                  Gene:
                                  PLOD1 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000001.10:g.12013510G>A, NC_000001.11:g.11953453G>A, NG_008159.1:g.23765G>A, NM_000302.3:c.579+718G>A, NM_001316320.1:c.720+718G>A, XM_005263474.1:c.720+718G>A
                                  20.

                                  rs796404865 [Homo sapiens]
                                    CTATCTCTTCAAAAATTAAAAAAAA[-/A]TAGCCAAGTGTGGTGGCTTGAACCT
                                    Chromosome:
                                    1:11961236
                                    Gene:
                                    PLOD1 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000001.10:g.12021293delA, NC_000001.11:g.11961236delA, NG_008159.1:g.31548delA, NM_000302.3:c.1097+469delA, NM_001316320.1:c.1238+469delA, XM_005263474.1:c.1238+469delA

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center