Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 342

1.

rs801197593 [Bos taurus]
    CAGAAACACCAAGAGTTCTGCCCAA[C/T]ACTCAAACCTCAAAATGACATTAGG
    Chromosome:
    17:35467322
    Gene:
    IL21 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    2.

    rs800959274 [Bos taurus]
      CCAGTAATTAGGACACTACAAAGGG[G/T]AGACTTATGAAGATACATTGCAAAG
      Chromosome:
      17:35463898
      Gene:
      IL21 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      3.

      rs800853475 [Bos taurus]
        TGACTAACACACCATAGCATAATTC[A/C]CCCAAAGCTGCCACAAGCCATAATG
        Chromosome:
        17:35467215
        Gene:
        IL21 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        4.

        rs800719114 [Bos taurus]
          CTTTCCCTCTTCTAGGGGATTGCAC[G/T]TGTGAGCAAATGAACTCTTAATTAC
          Chromosome:
          17:35468476
          Gene:
          IL21 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          no info
          5.

          rs800364624 [Bos taurus]
            ACACACACACACACACACACACGCA[C/T]ACACACGCAGCCAGAGCCTCCAGTG
            Chromosome:
            17:35467857
            Gene:
            IL21 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            no info
            6.

            rs798895694 [Bos taurus]
              CTTTATAAGGGACAGTCTTCCCTCC[A/C]TTGTGGGTATGGGGGTGGGGAGGGC
              Chromosome:
              17:35466610
              Gene:
              IL21 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              7.

              rs798336930 [Bos taurus]
                GAAATAAAATTTTGGTTGGAGAGGA[A/G]TGAGTATTAGCTTTTTAATTCACTT
                Chromosome:
                17:35461862
                Gene:
                IL21 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by cluster
                8.

                rs797475652 [Bos taurus]
                  CTAACACACCATAGCATAATTCACC[A/C]AAAGCTGCCACAAGCCATAATGTAA
                  Chromosome:
                  17:35467218
                  Gene:
                  IL21 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  no info
                  9.

                  rs797081016 [Bos taurus]
                    TTGGCATTATCTGGAAAACTTTCTG[A/G]TTGCCACAGTTGTGTGTGTGGAGGT
                    Chromosome:
                    17:35464720
                    Gene:
                    IL21 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    10.

                    rs730531014 [Bos taurus]
                      GATTCTAAGTAGCACTAAAAACTTC[-/A]AAACTTTTTTATGGCAAATACAGCC
                      Chromosome:
                      17:35460819
                      Gene:
                      IL21 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      11.

                      rs723009046 [Bos taurus]
                        CTAAGTAGCACTAAAAACTTCAAAA[C/G]TTTTTTATGGCAAATACAGCCACAC
                        Chromosome:
                        17:35460823
                        Gene:
                        IL21 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        12.

                        rs721066195 [Bos taurus]
                          TTTGTAAATCTATGAAACATAGACA[C/T]AAATCATAGAAGCAGGATTCAGTTT
                          Chromosome:
                          17:35463384
                          Gene:
                          IL21 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          no info
                          13.

                          rs720653802 [Bos taurus]
                            CCTTAAAATATTTTATCCTTTTAAC[-/TTAAT]TTATTAATTCTACTTTTAGTAGTTT
                            Chromosome:
                            17:35469107
                            Gene:
                            IL21 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by cluster
                            14.

                            rs720229214 [Bos taurus]
                              AGACAACGAAAAGATAATCAACATA[C/T]TAACTAAACAGCTGAAGAGGAAACT
                              Chromosome:
                              17:35467697
                              Gene:
                              IL21 (GeneView)
                              Functional Consequence:
                              synonymous codon
                              Validated:
                              no info
                              15.

                              rs719195656 [Bos taurus]
                                TGTCTGTGAGACAGGGAAGCATCCT[C/T]TCGCCCCTAACATGGGGGAATTTCA
                                Chromosome:
                                17:35467409
                                Gene:
                                IL21 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                no info
                                16.

                                rs717404635 [Bos taurus]
                                  ATGCAAGTTAAGAAAAGAAATCCTA[-/T]TTTTTTCCAATTAAAAAATTTTAAC
                                  Chromosome:
                                  17:35468987
                                  Gene:
                                  IL21 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by cluster
                                  17.

                                  rs717234741 [Bos taurus]
                                    GCTTTAACTGCATAAATTAGAATAA[C/G]TATAAAAGTACTACCAGTAATTAGG
                                    Chromosome:
                                    17:35463859
                                    Gene:
                                    IL21 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    no info
                                    18.

                                    rs717043421 [Bos taurus]
                                      CAGGACACATATCAAAATATTGCAG[C/T]TATTATCTCTGAGATTAGGATGTCA
                                      Chromosome:
                                      17:35469415
                                      Gene:
                                      IL21 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      19.

                                      rs717037154 [Bos taurus]
                                        GATGAGGGAAGCAAAGCCTTGCCTC[C/T]GAGTCTGCAAGGCACAGCAAAGGAA
                                        Chromosome:
                                        17:35465186
                                        Gene:
                                        IL21 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        no info
                                        20.

                                        rs716551147 [Bos taurus]
                                          GGCACAGCAAAGGAAAGCAGTGGCT[C/G]TGCTCCCAGATGGTGGTGCTGCACA
                                          Chromosome:
                                          17:35465222
                                          Gene:
                                          IL21 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          no info

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center