Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 672

1.

rs797044929 [Homo sapiens]
    GCCATCGCTGGTGTGCTAACAATTG[C/T]CCTGCCCGTACCTGTCATTGTGTCC
    Chromosome:
    12:4912580
    Gene:
    KCNA1 (GeneView)
    Functional Consequence:
    missense
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000012.11:g.5021746C>T, NC_000012.12:g.4912580C>T, NG_011815.1:g.7674C>T, NM_000217.2:c.1202C>T, NP_000208.2:p.Ala401Val
    2.

    rs796578673 [Homo sapiens]
      GAGCTTAGAAGGCGGCAGGCGAAGA[-/G]GGGTAGGAGGGGGGAGAGCCGAGGA
      Chromosome:
      12:4910887
      Gene:
      KCNA1 (GeneView)
      Functional Consequence:
      utr variant 5 prime
      Validated:
      by frequency
      HGVS:
      NC_000012.11:g.5020053delG, NC_000012.12:g.4910887delG, NG_011815.1:g.5981delG, NM_000217.2:c.-492delG
      3.

      rs781506153 [Homo sapiens]
        CAAAAAAGCCCCACTTAGCAGCTCA[A/G]AAGACTTAAAAAACAAAACAGAAAA
        Chromosome:
        12:4912910
        Gene:
        KCNA1 (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Validated:
        no info
        HGVS:
        NC_000012.11:g.5022076A>G, NC_000012.12:g.4912910A>G, NG_011815.1:g.8004A>G, NM_000217.2:c.*44A>G
        4.

        rs781376867 [Homo sapiens]
          TTGAAGACAGTGCATCAGATGTATT[A/G]TATGTAACATGATAGACCAGCCAAA
          Chromosome:
          12:4913341
          Gene:
          KCNA1 (GeneView)
          Functional Consequence:
          utr variant 3 prime
          Validated:
          no info
          HGVS:
          NC_000012.11:g.5022507A>G, NC_000012.12:g.4913341A>G, NG_011815.1:g.8435A>G, NM_000217.2:c.*475A>G
          5.

          rs781127002 [Homo sapiens]
            TCATCGTGGAAACGCTGTGTATCAT[A/C]TGGTTCTCCTTCGAGCTGGTGGTGC
            Chromosome:
            12:4912068
            Gene:
            KCNA1 (GeneView)
            Functional Consequence:
            synonymous codon
            Validated:
            no info
            HGVS:
            NC_000012.11:g.5021234C>A, NC_000012.12:g.4912068C>A, NG_011815.1:g.7162C>A, NM_000217.2:c.690C>A, NP_000208.2:p.Ile230
            6.

            rs781075600 [Homo sapiens]
              CTCCATCGTCATCTTTTGCCTGGAG[A/G]CGCTCCCCGAGCTGAAGGATGACAA
              Chromosome:
              12:4911940
              Gene:
              KCNA1 (GeneView)
              Functional Consequence:
              missense
              Validated:
              no info
              HGVS:
              NC_000012.11:g.5021106A>G, NC_000012.12:g.4911940A>G, NG_011815.1:g.7034A>G, NM_000217.2:c.562A>G, NP_000208.2:p.Thr188Ala
              7.

              rs780945447 [Homo sapiens]
                GTATGACTCAGGTAAACCTTTAAAG[-/A]ATGTATGTTACTTACCATTTTTGTA
                Chromosome:
                12:4917375
                Gene:
                KCNA1 (GeneView)
                Functional Consequence:
                utr variant 3 prime
                Validated:
                by cluster
                HGVS:
                NC_000012.11:g.5026541delA, NC_000012.12:g.4917375delA, NG_011815.1:g.12469delA, NM_000217.2:c.*4509delA
                8.

                rs780834906 [Homo sapiens]
                  TTAAGGAGATTAACCCTAGTCACAG[C/T]GATTTTCATTTAGGAGCTAACTAGG
                  Chromosome:
                  12:4917634
                  Gene:
                  KCNA1 (GeneView)
                  Functional Consequence:
                  utr variant 3 prime
                  Validated:
                  no info
                  HGVS:
                  NC_000012.11:g.5026800T>C, NC_000012.12:g.4917634T>C, NG_011815.1:g.12728T>C, NM_000217.2:c.*4768T>C
                  9.

                  rs780679436 [Homo sapiens]
                    ATCTCATCCAATCTGTGAATCCCTT[A/G]TAGTAAGGCAATCTCCTAATGCTGA
                    Chromosome:
                    12:4908150
                    Gene:
                    KCNA1 (GeneView)
                    Functional Consequence:
                    upstream variant 2KB
                    Validated:
                    no info
                    HGVS:
                    NC_000012.11:g.5017316G>A, NC_000012.12:g.4908150G>A, NG_011815.1:g.3244G>A, NM_000217.2:c.-2862G>A
                    10.

                    rs780278287 [Homo sapiens]
                      ATACAATTTATTTTATAATCGCATG[C/T]TGAGAAGTTAACCCAGACAATAGGG
                      Chromosome:
                      12:4913768
                      Gene:
                      KCNA1 (GeneView)
                      Functional Consequence:
                      utr variant 3 prime
                      Validated:
                      no info
                      HGVS:
                      NC_000012.11:g.5022934C>T, NC_000012.12:g.4913768C>T, NG_011815.1:g.8862C>T, NM_000217.2:c.*902C>T
                      11.

                      rs780237417 [Homo sapiens]
                        TCCAAGCTCCTAAGGGCTCCTGGCG[C/T]GCCGCGTAGCCTTGGCGAGGTCCGC
                        Chromosome:
                        12:4909975
                        Gene:
                        KCNA1 (GeneView)
                        Functional Consequence:
                        utr variant 5 prime
                        Validated:
                        no info
                        HGVS:
                        NC_000012.11:g.5019141C>T, NC_000012.12:g.4909975C>T, NG_011815.1:g.5069C>T, NM_000217.2:c.-1037C>T
                        12.

                        rs780167432 [Homo sapiens]
                          TAATAGCATAGCCCATTATAGACAG[A/G/T]TCAATATCAGAACTGCCAATTGCAC
                          Chromosome:
                          12:4912789
                          Gene:
                          KCNA1 (GeneView)
                          Functional Consequence:
                          missense
                          Validated:
                          by frequency
                          HGVS:
                          NC_000012.11:g.5021955G>A, NC_000012.11:g.5021955G>T, NC_000012.12:g.4912789G>A, NC_000012.12:g.4912789G>T, NG_011815.1:g.7883G>A, NG_011815.1:g.7883G>T, NM_000217.2:c.1411G>A, NM_000217.2:c.1411G>T, NP_000208.2:p.Val471Ile, NP_000208.2:p.Val471Phe
                          13.

                          rs780062452 [Homo sapiens]
                            AAGTTCCGGGAGGACGAGGGCTTCA[C/T]CAAGGAGGAGGAGCGCCCTCTGCCC
                            Chromosome:
                            12:4911788
                            Gene:
                            KCNA1 (GeneView)
                            Functional Consequence:
                            missense
                            Validated:
                            no info
                            HGVS:
                            NC_000012.11:g.5020954T>C, NC_000012.12:g.4911788T>C, NG_011815.1:g.6882T>C, NM_000217.2:c.410T>C, NP_000208.2:p.Ile137Thr
                            14.

                            rs780031417 [Homo sapiens]
                              GAGTTAAGGACGTGTCTCATCTTCA[C/T]CTACTGCGCATTCTCCCTTCTCTAA
                              Chromosome:
                              12:4918071
                              Gene:
                              KCNA1 (GeneView)
                              Functional Consequence:
                              utr variant 3 prime
                              Validated:
                              no info
                              HGVS:
                              NC_000012.11:g.5027237C>T, NC_000012.12:g.4918071C>T, NG_011815.1:g.13165C>T, NM_000217.2:c.*5205C>T
                              15.

                              rs779989266 [Homo sapiens]
                                TTGCCGAGGCGGAAGAAGCTGAGTC[A/G]CACTTCTCCAGTATCCCCGATGCTT
                                Chromosome:
                                12:4912440
                                Gene:
                                KCNA1 (GeneView)
                                Functional Consequence:
                                synonymous codon
                                Validated:
                                no info
                                HGVS:
                                NC_000012.11:g.5021606G>A, NC_000012.12:g.4912440G>A, NG_011815.1:g.7534G>A, NM_000217.2:c.1062G>A, NP_000208.2:p.Ser354
                                16.

                                rs779873859 [Homo sapiens]
                                  AACTGAGGGGGAAGAGCAGGCTCAG[A/T]TGCTCCACGTCAGTTCCCCTAACTT
                                  Chromosome:
                                  12:4912657
                                  Gene:
                                  KCNA1 (GeneView)
                                  Functional Consequence:
                                  missense
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000012.11:g.5021823T>A, NC_000012.12:g.4912657T>A, NG_011815.1:g.7751T>A, NM_000217.2:c.1279T>A, NP_000208.2:p.Leu427Met
                                  17.

                                  rs779820856 [Homo sapiens]
                                    TGTTTTCTAGTGCAGTGTACTTTGC[C/T]GAGGCGGAAGAAGCTGAGTCGCACT
                                    Chromosome:
                                    12:4912419
                                    Gene:
                                    KCNA1 (GeneView)
                                    Functional Consequence:
                                    synonymous codon
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000012.11:g.5021585C>T, NC_000012.12:g.4912419C>T, NG_011815.1:g.7513C>T, NM_000217.2:c.1041C>T, NP_000208.2:p.Ala347
                                    18.

                                    rs779800271 [Homo sapiens]
                                      ACATTTTAATTCTTAGTTTGGTAGA[C/T]TGGATTGAAAGAAAGGAGAAAGAAC
                                      Chromosome:
                                      12:4916997
                                      Gene:
                                      KCNA1 (GeneView)
                                      Functional Consequence:
                                      utr variant 3 prime
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000012.11:g.5026163T>C, NC_000012.12:g.4916997T>C, NG_011815.1:g.12091T>C, NM_000217.2:c.*4131T>C
                                      19.

                                      rs779693458 [Homo sapiens]
                                        CTGCTGTCCAAGGACATATCCGGGG[G/T]TTACCTTTTGAGGATAAATTCAGTT
                                        Chromosome:
                                        12:4918430
                                        Gene:
                                        KCNA1 (GeneView)
                                        Functional Consequence:
                                        downstream variant 500B
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000012.11:g.5027596G>T, NC_000012.12:g.4918430G>T, NG_011815.1:g.13524G>T, NM_000217.2:c.*5564G>T
                                        20.

                                        rs779662091 [Homo sapiens]
                                          GTTACTGTGGGACTGCACAAAAGCA[A/T]ACCCGTCGGAGGAGTTTTGCCAGAA
                                          Chromosome:
                                          12:4909545
                                          Gene:
                                          KCNA1 (GeneView)
                                          Functional Consequence:
                                          upstream variant 2KB
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000012.11:g.5018711A>T, NC_000012.12:g.4909545A>T, NG_011815.1:g.4639A>T, NM_000217.2:c.-1467A>T

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center