Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 903

1.

rs796128629 [Homo sapiens]
    CCAGGATCCCTGTTCCTGCCAAAGG[-/C]CTTGTGGGAAACGATTCCCTCTGGA
    Chromosome:
    11:2001312
    Gene:
    H19 (GeneView) MRPL23 (GeneView)
    Functional Consequence:
    intron variant,nc transcript variant
    Validated:
    by frequency
    HGVS:
    NC_000011.10:g.2001312delC, NC_000011.9:g.2022542delC, NG_016165.1:g.1524delG, NR_131224.1:n.155delG, XM_011520273.1:c.498-10229delC, XM_011520275.2:c.498-10229delC
    3.

    rs781753238 [Homo sapiens]
      GAAGGATGAAAAAGAAGAAGAGGGA[C/G]GTGGTGGGGACGGCGTCATCCCGCT
      Chromosome:
      11:1995604
      Gene:
      H19 (GeneView) HOTS (GeneView) MRPL23 (GeneView)
      Functional Consequence:
      intron variant,missense,nc transcript variant
      Validated:
      no info
      HGVS:
      NC_000011.10:g.1995604G>C, NC_000011.9:g.2016834G>C, NG_016165.1:g.7232C>G, NG_045220.1:g.8197G>C, NM_001293171.2:c.408G>C, NP_001280100.1:p.Glu136Asp, NR_002196.2:n.1920C>G, NR_131223.1:n.1914C>G, NR_131224.1:n.811C>G, XM_011520273.1:c.498-15937G>C, XM_011520275.2:c.498-15937G>C
      4.

      rs781709751 [Homo sapiens]
        CGATCCCGGCTCCGTCGCCGCCCGC[A/G]AGGCCCGCCTTGGCCACGGGCTCTG
        Chromosome:
        11:1996572
        Gene:
        H19 (GeneView) HOTS (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
        Functional Consequence:
        downstream variant 500B,intron variant,nc transcript variant
        Validated:
        no info
        HGVS:
        NC_000011.10:g.1996572G>A, NC_000011.9:g.2017802G>A, NG_016165.1:g.6264C>T, NG_045220.1:g.9165G>A, NM_001293171.2:c.*920G>A, NR_002196.2:n.1304C>T, NR_030533.1:n.260C>T, NR_131223.1:n.1304C>T, NR_131224.1:n.250-151C>T, XM_011520273.1:c.498-14969G>A, XM_011520275.2:c.498-14969G>A
        5.

        rs781707071 [Homo sapiens]
          CCGGTGCGGGGTGGGTGCTGCGGGC[A/G]CTGCTGTTCCGATGGTGTCTTTGAT
          Chromosome:
          11:1995734
          Gene:
          H19 (GeneView) HOTS (GeneView) MRPL23 (GeneView)
          Functional Consequence:
          intron variant,nc transcript variant,utr variant 3 prime
          Validated:
          by frequency
          HGVS:
          NC_000011.10:g.1995734G>A, NC_000011.9:g.2016964G>A, NG_016165.1:g.7102C>T, NG_045220.1:g.8327G>A, NM_001293171.2:c.*82G>A, NR_002196.2:n.1790C>T, NR_131223.1:n.1784C>T, NR_131224.1:n.681C>T, XM_011520273.1:c.498-15807G>A, XM_011520275.2:c.498-15807G>A
          6.

          rs781635699 [Homo sapiens]
            GCCCGGCAGATGGGGTCCTCACCTG[C/T]CCGCTGCTGCCAGCTACACCTCCGT
            Chromosome:
            11:1997427
            Gene:
            H19 (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
            Functional Consequence:
            intron variant,nc transcript variant,upstream variant 2KB
            Validated:
            no info
            HGVS:
            NC_000011.10:g.1997427C>T, NC_000011.9:g.2018657C>T, NG_016165.1:g.5409G>A, NG_045220.1:g.10020C>T, NR_002196.2:n.449G>A, NR_030533.1:n.-596G>A, NR_131223.1:n.449G>A, NR_131224.1:n.250-1006G>A, XM_011520273.1:c.498-14114C>T, XM_011520275.2:c.498-14114C>T
            7.

            rs781443436 [Homo sapiens]
              GCCCAGTCACCCGGCCCAGATGGAG[C/G]GCGGCCGGGCCCTGCACAGGCACTT
              Chromosome:
              11:1995373
              Gene:
              H19 (GeneView) HOTS (GeneView) MRPL23 (GeneView)
              Functional Consequence:
              intron variant,missense,nc transcript variant
              Validated:
              no info
              HGVS:
              NC_000011.10:g.1995373G>C, NC_000011.9:g.2016603G>C, NG_016165.1:g.7463C>G, NG_045220.1:g.7966G>C, NM_001293171.2:c.177G>C, NP_001280100.1:p.Arg59Ser, NR_002196.2:n.2151C>G, NR_131223.1:n.2145C>G, NR_131224.1:n.1042C>G, XM_011520273.1:c.498-16168G>C, XM_011520275.2:c.498-16168G>C
              8.

              rs781259988 [Homo sapiens]
                TCCAGCCCTCGAGGCTCCGGCATAG[A/G]CCTGAGAAAGCCGTGCCGGAGCTGC
                Chromosome:
                11:1997005
                Gene:
                H19 (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
                Functional Consequence:
                intron variant,nc transcript variant,upstream variant 2KB
                Validated:
                no info
                HGVS:
                NC_000011.10:g.1997005G>A, NC_000011.9:g.2018235G>A, NG_016165.1:g.5831C>T, NG_045220.1:g.9598G>A, NR_002196.2:n.871C>T, NR_030533.1:n.-174C>T, NR_131223.1:n.871C>T, NR_131224.1:n.250-584C>T, XM_011520273.1:c.498-14536G>A, XM_011520275.2:c.498-14536G>A
                9.

                rs781258292 [Homo sapiens]
                  GCTGGGAGGGTGTCTGCTTCTCCCC[A/G]CCAGCCCTCGATCCCCTAAACCTCC
                  Chromosome:
                  11:1997325
                  Gene:
                  H19 (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
                  Functional Consequence:
                  intron variant,nc transcript variant,upstream variant 2KB
                  Validated:
                  by frequency
                  HGVS:
                  NC_000011.10:g.1997325G>A, NC_000011.9:g.2018555G>A, NG_016165.1:g.5511C>T, NG_045220.1:g.9918G>A, NR_002196.2:n.551C>T, NR_030533.1:n.-494C>T, NR_131223.1:n.551C>T, NR_131224.1:n.250-904C>T, XM_011520273.1:c.498-14216G>A, XM_011520275.2:c.498-14216G>A
                  10.

                  rs781227125 [Homo sapiens]
                    GGATCTCACCCTGAGGCCAAGATCC[C/G]CATCATCCAAAGAATGGGGACACTT
                    Chromosome:
                    11:2000545
                    Gene:
                    H19 (GeneView) MRPL23 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    HGVS:
                    NC_000011.10:g.2000545C>G, NC_000011.9:g.2021775C>G, NG_016165.1:g.2291G>C, NR_131224.1:n.249+673G>C, XM_011520273.1:c.498-10996C>G, XM_011520275.2:c.498-10996C>G
                    11.

                    rs781130471 [Homo sapiens]
                      ATGTTGTGGGTTCTGGGAGCCCAGA[A/G]GGCAGCCATAGTGTGCCGACTCCGT
                      Chromosome:
                      11:1996109
                      Gene:
                      H19 (GeneView) HOTS (GeneView) MRPL23 (GeneView)
                      Functional Consequence:
                      intron variant,nc transcript variant,utr variant 3 prime
                      Validated:
                      no info
                      HGVS:
                      NC_000011.10:g.1996109G>A, NC_000011.9:g.2017339G>A, NG_016165.1:g.6727C>T, NG_045220.1:g.8702G>A, NM_001293171.2:c.*457G>A, NR_002196.2:n.1576C>T, NR_131223.1:n.1576C>T, NR_131224.1:n.467C>T, XM_011520273.1:c.498-15432G>A, XM_011520275.2:c.498-15432G>A
                      12.

                      rs781062377 [Homo sapiens]
                        TGAGGTCCCACTCAGCTCCTCTCGC[A/G]TGCCCCCCACCCCAAGTGTGGCAGG
                        Chromosome:
                        11:1996042
                        Gene:
                        H19 (GeneView) HOTS (GeneView) MRPL23 (GeneView)
                        Functional Consequence:
                        intron variant,utr variant 3 prime
                        Validated:
                        no info
                        HGVS:
                        NC_000011.10:g.1996042G>A, NC_000011.9:g.2017272G>A, NG_016165.1:g.6794C>T, NG_045220.1:g.8635G>A, NM_001293171.2:c.*390G>A, NR_002196.2:n.1606+37C>T, NR_131223.1:n.1606+37C>T, NR_131224.1:n.497+37C>T, XM_011520273.1:c.498-15499G>A, XM_011520275.2:c.498-15499G>A
                        13.

                        rs780940163 [Homo sapiens]
                          ACAGGAAAGCTCAGAAACAAAGAGA[C/T]AGAAGGATGAAAAAGAAGAAGAGGG
                          Chromosome:
                          11:1995577
                          Gene:
                          H19 (GeneView) HOTS (GeneView) MRPL23 (GeneView)
                          Functional Consequence:
                          intron variant,nc transcript variant,synonymous codon
                          Validated:
                          no info
                          HGVS:
                          NC_000011.10:g.1995577C>T, NC_000011.9:g.2016807C>T, NG_016165.1:g.7259G>A, NG_045220.1:g.8170C>T, NM_001293171.2:c.381C>T, NP_001280100.1:p.Asp127, NR_002196.2:n.1947G>A, NR_131223.1:n.1941G>A, NR_131224.1:n.838G>A, XM_011520273.1:c.498-15964C>T, XM_011520275.2:c.498-15964C>T
                          15.

                          rs780833624 [Homo sapiens]
                            CAATGCGGTGCCTGGCCTGTTGACC[C/T]GGGATGTTTCTGCAGGCAAACCACA
                            Chromosome:
                            11:2001124
                            Gene:
                            H19 (GeneView) MRPL23 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            no info
                            HGVS:
                            NC_000011.10:g.2001124C>T, NC_000011.9:g.2022354C>T, NG_016165.1:g.1712G>A, NR_131224.1:n.249+94G>A, XM_011520273.1:c.498-10417C>T, XM_011520275.2:c.498-10417C>T
                            16.

                            rs780752626 [Homo sapiens]
                              AGGGAAGGGACTCACCTGCCCGGCA[C/G]ATGGGGTCCTCACCTGCCCGCTGCT
                              Chromosome:
                              11:1997410
                              Gene:
                              H19 (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
                              Functional Consequence:
                              intron variant,nc transcript variant,upstream variant 2KB
                              Validated:
                              by cluster
                              HGVS:
                              NC_000011.10:g.1997410G>C, NC_000011.9:g.2018640G>C, NG_016165.1:g.5426C>G, NG_045220.1:g.10003G>C, NR_002196.2:n.466C>G, NR_030533.1:n.-579C>G, NR_131223.1:n.466C>G, NR_131224.1:n.250-989C>G, XM_011520273.1:c.498-14131G>C, XM_011520275.2:c.498-14131G>C
                              17.

                              rs780705722 [Homo sapiens]
                                GGAAGGCCGGACGCGCCTCCTCTGT[C/T]CTCGCCGTCACACCGGACCATGTCA
                                Chromosome:
                                11:1996314
                                Gene:
                                H19 (GeneView) HOTS (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
                                Functional Consequence:
                                downstream variant 500B,intron variant,nc transcript variant
                                Validated:
                                no info
                                HGVS:
                                NC_000011.10:g.1996314C>T, NC_000011.9:g.2017544C>T, NG_016165.1:g.6522G>A, NG_045220.1:g.8907C>T, NM_001293171.2:c.*662C>T, NR_002196.2:n.1466G>A, NR_030533.1:n.518G>A, NR_131223.1:n.1466G>A, NR_131224.1:n.357G>A, XM_011520273.1:c.498-15227C>T, XM_011520275.2:c.498-15227C>T
                                18.

                                rs780692720 [Homo sapiens]
                                  GAGCTCAGCTCTGGGATGATGTGGT[A/G]GCTGGTGGTCAACCGTCCGCCGCAG
                                  Chromosome:
                                  11:1995659
                                  Gene:
                                  H19 (GeneView) HOTS (GeneView) MRPL23 (GeneView)
                                  Functional Consequence:
                                  intron variant,nc transcript variant,utr variant 3 prime
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000011.10:g.1995659G>A, NC_000011.9:g.2016889G>A, NG_016165.1:g.7177C>T, NG_045220.1:g.8252G>A, NM_001293171.2:c.*7G>A, NR_002196.2:n.1865C>T, NR_131223.1:n.1859C>T, NR_131224.1:n.756C>T, XM_011520273.1:c.498-15882G>A, XM_011520275.2:c.498-15882G>A
                                  19.
                                  20.

                                  rs780658841 [Homo sapiens]
                                    AACCCTCTGTTCCCATGGCCCCACC[A/G]GAAAGGGCTGAGTGCTTGCCTGCTG
                                    Chromosome:
                                    11:1998836
                                    Gene:
                                    H19 (GeneView) MRPL23 (GeneView)
                                    Functional Consequence:
                                    intron variant,upstream variant 2KB
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000011.10:g.1998836G>A, NC_000011.9:g.2020066G>A, NG_016165.1:g.4000C>T, NR_002196.2:n.-961C>T, NR_131223.1:n.-961C>T, NR_131224.1:n.249+2382C>T, XM_011520273.1:c.498-12705G>A, XM_011520275.2:c.498-12705G>A

                                    Display Settings:

                                    Format
                                    Items per page
                                    Sort by

                                    Send to:

                                    Choose Destination

                                    Supplemental Content

                                    Find related data

                                    Recent activity

                                    Your browsing activity is empty.

                                    Activity recording is turned off.

                                    Turn recording back on

                                    See more...
                                    Support Center