Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 7126

1.

rs797016431 [Homo sapiens]
    GACAGAGTCTCACTCTGTCGCCCAG[A/G/T]CTGGAGTGCAGTGGTGTGATCTCGG
    Chromosome:
    3:37308661
    Gene:
    GOLGA4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000003.11:g.37350152G>A, NC_000003.11:g.37350152G>T, NC_000003.12:g.37308661G>A, NC_000003.12:g.37308661G>T, NG_047053.1:g.70471G>A, NG_047053.1:g.70471G>T, NM_001172713.1:c.1300+6329G>A, NM_001172713.1:c.1300+6329G>T, NM_002078.4:c.1234+6329G>A, NM_002078.4:c.1234+6329G>T, XM_005265069.1:c.1399+6329G>A, XM_005265069.1:c.1399+6329G>T, XM_005265069.3:c.1399+6329G>A, XM_005265069.3:c.1399+6329G>T, XM_005265070.1:c.1399+6329G>A, XM_005265070.1:c.1399+6329G>T, XM_005265070.3:c.1399+6329G>A, XM_005265070.3:c.1399+6329G>T, XM_005265071.1:c.1399+6329G>A, XM_005265071.1:c.1399+6329G>T, XM_005265071.3:c.1399+6329G>A, XM_005265071.3:c.1399+6329G>T, XM_005265072.1:c.1351+6329G>A, XM_005265072.1:c.1351+6329G>T, XM_005265072.3:c.1351+6329G>A, XM_005265072.3:c.1351+6329G>T, XM_005265073.1:c.1300+6329G>A, XM_005265073.1:c.1300+6329G>T, XM_005265074.1:c.1300+6329G>A, XM_005265074.1:c.1300+6329G>T, XM_005265075.1:c.1186+6329G>A, XM_005265075.1:c.1186+6329G>T, XM_006713110.2:c.1294+6329G>A, XM_006713110.2:c.1294+6329G>T, XM_011533598.2:c.-409+6329G>A, XM_011533598.2:c.-409+6329G>T, XM_017006184.1:c.1399+6329G>A, XM_017006184.1:c.1399+6329G>T, XM_017006185.1:c.1297+6329G>A, XM_017006185.1:c.1297+6329G>T, XM_017006186.1:c.1297+6329G>A, XM_017006186.1:c.1297+6329G>T, XM_017006187.1:c.1252+6329G>A, XM_017006187.1:c.1252+6329G>T, XM_017006188.1:c.1129+6329G>A, XM_017006188.1:c.1129+6329G>T

    Display Settings:

    Format
    Items per page
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center