Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 4333

1.

rs796934134 [Homo sapiens]
    AACCAGGCATGGTGGCAGGTGCCTG[A/T]AATCCCAGCTACTCGGGAGGCTGAG
    Chromosome:
    19:42365960
    Gene:
    MEGF8 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    HGVS:
    NC_000019.10:g.42365960T>A, NC_000019.9:g.42870112T>A, NG_033030.1:g.45352T>A, NM_001271938.1:c.6274-2495T>A, NM_001410.2:c.6073-2495T>A, XM_005258611.1:c.6106-2495T>A, XM_005258612.1:c.6274-2495T>A, XM_005258613.1:c.6274-2495T>A, XM_005258614.1:c.6274-2495T>A
    2.

    rs796927843 [Homo sapiens]
      AAGAGGAACCGGGGGGGGGGGGGGG[G/T]GGGGGGGGGGGGGAGGCCGGGGATC
      Chromosome:
      19:42370859
      Gene:
      MEGF8 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000019.10:g.42370859G>T, NC_000019.9:g.42875011G>T, NG_033030.1:g.50251G>T, NM_001271938.1:c.7136+28G>T, NM_001410.2:c.6935+28G>T, XM_005258611.1:c.6968+28G>T, XM_005258612.1:c.7136+28G>T, XM_005258613.1:c.7136+28G>T, XM_005258614.1:c.7136+28G>T
      6.

      rs796395899 [Homo sapiens]
        TCTCAAAAAAAAAAAAAAAAAAAAA[A/G]AAAAAGAAAAAGAAAAAAAAGTCAC
        Chromosome:
        19:42347006
        Gene:
        MEGF8 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by cluster
        HGVS:
        NC_000019.10:g.42347006G>A, NC_000019.9:g.42851158G>A, NG_033030.1:g.26398G>A, NM_001271938.1:c.2098-1266G>A, NM_001410.2:c.2097+2173G>A, XM_005258611.1:c.2098-1266G>A, XM_005258612.1:c.2098-1266G>A, XM_005258613.1:c.2098-1266G>A, XM_005258614.1:c.2098-1266G>A
        7.

        rs796358861 [Homo sapiens]
          TTTCTTTTTTTTTTTTTTTTTTTGA[A/G]ACGGAGTCTCGCTGTTGCCCAGGCT
          Chromosome:
          19:42337528
          Gene:
          MEGF8 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          no info
          HGVS:
          NC_000019.10:g.42337528G>A, NC_000019.9:g.42841680G>A, NG_033030.1:g.16920G>A, NM_001271938.1:c.1513+322G>A, NM_001410.2:c.1513+322G>A, XM_005258611.1:c.1513+322G>A, XM_005258612.1:c.1513+322G>A, XM_005258613.1:c.1513+322G>A, XM_005258614.1:c.1513+322G>A
          8.

          rs796227411 [Homo sapiens]
            TCAGACCCTGACCCTAGTATTGCTG[-/T]TTTTTTTTTTTTGTTTTTTTAATCC
            Chromosome:
            19:42354119
            Gene:
            MEGF8 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            no info
            HGVS:
            NC_000019.10:g.42354119delT, NC_000019.9:g.42858271delT, NG_033030.1:g.33511delT, NM_001271938.1:c.4011+95delT, NM_001410.2:c.3810+95delT, XM_005258611.1:c.4011+95delT, XM_005258612.1:c.4011+95delT, XM_005258613.1:c.4011+95delT, XM_005258614.1:c.4011+95delT
            10.

            rs796161253 [Homo sapiens]
              GTACCACATTTTCTTTTTTTTTTTT[C/T]CTTTCTATGTATTTTTTTTTTTTTT
              Chromosome:
              19:42338814
              Gene:
              MEGF8 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by frequency
              HGVS:
              NC_000019.10:g.42338814T>C, NC_000019.9:g.42842966T>C, NG_033030.1:g.18206T>C, NM_001271938.1:c.1513+1608T>C, NM_001410.2:c.1513+1608T>C, XM_005258611.1:c.1513+1608T>C, XM_005258612.1:c.1513+1608T>C, XM_005258613.1:c.1513+1608T>C, XM_005258614.1:c.1513+1608T>C
              11.

              rs781781635 [Homo sapiens]
                AGCTCACTGCAGGCTCCACCCCCCG[A/G]GTTTCACGCCATTCTCCTGCCTCAG
                Chromosome:
                19:42337600
                Gene:
                MEGF8 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                no info
                HGVS:
                NC_000019.10:g.42337600G>A, NC_000019.9:g.42841752G>A, NG_033030.1:g.16992G>A, NM_001271938.1:c.1513+394G>A, NM_001410.2:c.1513+394G>A, XM_005258611.1:c.1513+394G>A, XM_005258612.1:c.1513+394G>A, XM_005258613.1:c.1513+394G>A, XM_005258614.1:c.1513+394G>A
                12.
                14.

                rs781654259 [Homo sapiens]
                  GGGGGTGGGATGGGCACTGGGAGTC[A/C]AAAGGAAAGGGCTGAGTGGGGTTCT
                  Chromosome:
                  19:42351164
                  Gene:
                  MEGF8 (GeneView) MIR8077 (GeneView)
                  Functional Consequence:
                  intron variant,nc transcript variant
                  Validated:
                  by frequency
                  HGVS:
                  NC_000019.10:g.42351164C>A, NC_000019.9:g.42855316C>A, NG_033030.1:g.30556C>A, NM_001271938.1:c.2737-52C>A, NM_001410.2:c.2536-52C>A, NR_107044.1:n.34C>A, XM_005258611.1:c.2737-52C>A, XM_005258612.1:c.2737-52C>A, XM_005258613.1:c.2737-52C>A, XM_005258614.1:c.2737-52C>A
                  15.

                  rs781651536 [Homo sapiens]
                    GAGTCCTGCCCCGGTATGGACCCCT[A/C]CTCTGCCCTGGAGGAGCCTTTCCAC
                    Chromosome:
                    19:42335398
                    Gene:
                    MEGF8 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    HGVS:
                    NC_000019.10:g.42335398C>A, NC_000019.9:g.42839550C>A, NG_033030.1:g.14790C>A, NM_001271938.1:c.828+13C>A, NM_001410.2:c.828+13C>A, XM_005258611.1:c.828+13C>A, XM_005258612.1:c.828+13C>A, XM_005258613.1:c.828+13C>A, XM_005258614.1:c.828+13C>A
                    17.

                    rs781620846 [Homo sapiens]
                      CACCGAGTTCTCAGCTGGCTCAGGA[-/G]GGGTGCTGAGGGTCCCATCTAGCCT
                      Chromosome:
                      19:42362343
                      Gene:
                      MEGF8 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by frequency
                      HGVS:
                      NC_000019.10:g.42362343delG, NC_000019.9:g.42866495delG, NG_033030.1:g.41735delG, NM_001271938.1:c.5845-41delG, NM_001410.2:c.5644-41delG, XM_005258611.1:c.5677-41delG, XM_005258612.1:c.5845-41delG, XM_005258613.1:c.5845-41delG, XM_005258614.1:c.5845-41delG
                      20.

                      rs781545010 [Homo sapiens]
                        TATGGTTGAGTAATATTCCATTGTA[C/T]AGATGGACCACATTTTGTTTATCCA
                        Chromosome:
                        19:42345661
                        Gene:
                        MEGF8 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        NC_000019.10:g.42345661T>C, NC_000019.9:g.42849813T>C, NG_033030.1:g.25053T>C, NM_001271938.1:c.2097+828T>C, NM_001410.2:c.2097+828T>C, XM_005258611.1:c.2097+828T>C, XM_005258612.1:c.2097+828T>C, XM_005258613.1:c.2097+828T>C, XM_005258614.1:c.2097+828T>C

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center