Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 76

1.

rs586258371 [Mus musculus]
    GTGTCTGTGTGTGTGTGTGTGTGTG[C/T]GTCTGTGTGTGTGTGTGTGTGTCTG
    Chromosome:
    4:149694295
    Gene:
    Pik3cd (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    2.

    rs585500642 [Mus musculus]
      CTCGGAGTACCCACTCCCCCCCCCC[A/C]AAAAAAACAAAAAAACAAAAAAAAC
      Chromosome:
      4:149702427
      Gene:
      Pik3cd (GeneView)
      Functional Consequence:
      intron variant,upstream variant 2KB
      Validated:
      no info
      3.

      rs584606618 [Mus musculus]
        GGGCTACACAGAGAAACCCTGTCTC[A/G]AAAAACCAAACCAAACCAAACCAAA
        Chromosome:
        4:149661279
        Gene:
        Pik3cd (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        4.

        rs583329454 [Mus musculus]
          TGTTTTGTTTTGTTTTGTTTTGTTT[G/T]GTTTTTTTGAGACAGGGTTTCTCTA
          Chromosome:
          4:149673084
          Gene:
          Pik3cd (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          no info
          5.

          rs582756230 [Mus musculus]
            TGTGTGTGTGTGTGTGCGTCTGTGT[C/G]TGTGTGTGTGTGTCTGTGTGTGTGT
            Chromosome:
            4:149694304
            Gene:
            Pik3cd (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            no info
            6.

            rs580432025 [Mus musculus]
              TCTGTGTGTGTGTGTGTGTGTGCGT[C/G]TGTGTGTGTGTGTGTGTGTCTGTGT
              Chromosome:
              4:149694298
              Gene:
              Pik3cd (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              7.

              rs579141778 [Mus musculus]
                CACAGAGAAACCCTGTCTCAAAAAA[A/C]CAAACCAAACCAAACCAAACCAAAC
                Chromosome:
                4:149661285
                Gene:
                Pik3cd (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                no info
                8.

                rs578629825 [Mus musculus]
                  CTGAGGACCAAGTGAGAGGTGATTA[-/AAGAAG]AAGAAGAAGAAGAAGAAGAAGAAGA
                  Chromosome:
                  4:149684350
                  Gene:
                  Pik3cd (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  no info
                  9.

                  rs387484534 [Mus musculus]
                    CTGGCTGTCCTGGAACTCACTCTGT[-/T]AAACCAGGCTGACCTTGAACTCAGA
                    Chromosome:
                    4:149693239
                    Gene:
                    Pik3cd (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    10.

                    rs387475720 [Mus musculus]
                      TATAATATATAATATATAATATATA[-/ATA]TATACTTTTTTTTAAAAACAGGAGT
                      Chromosome:
                      4:149677673
                      Gene:
                      Pik3cd (GeneView)
                      Functional Consequence:
                      intron variant,upstream variant 2KB
                      Validated:
                      no info
                      11.

                      rs387395382 [Mus musculus]
                        ATAGGATTTTTTTTTTCTTTTTTTT[A/C/G/T]TTTTTTTTTTTTTTTTTTGGTTTTT
                        Chromosome:
                        4:149703298
                        Gene:
                        Pik3cd (GeneView)
                        Functional Consequence:
                        upstream variant 2KB
                        Validated:
                        no info
                        12.

                        rs387376967 [Mus musculus]
                          ATATATAATATATAATATATAATAT[A/G]TAATATATAATATATAATATATAAT
                          Chromosome:
                          4:149677642
                          Gene:
                          Pik3cd (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          no info
                          13.

                          rs387292118 [Mus musculus]
                            TGAACAGAAATCTGTTTGTTTGTTT[
                            -/ATTTGTTTGTTTGTTT
                            ]GTTTTTGAGACAGGGTTTCTCTGTA
                            Chromosome:
                            4:149695724
                            Gene:
                            Pik3cd (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            no info
                            14.

                            rs387150581 [Mus musculus]
                              TGGGTGTTTGTTTGTTTGTTTGTTT[-/GTTT]TCGAGACAGGGTTTCTCTGTGTAGC
                              Chromosome:
                              4:149693184
                              Gene:
                              Pik3cd (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              no info
                              15.

                              rs387134407 [Mus musculus]
                                GTATATATGTTTGTATATATACACA[-/TACACA]CACACACACATATATATTCTATAAA
                                Chromosome:
                                4:149680673
                                Gene:
                                Pik3cd (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                no info
                                16.

                                rs387042248 [Mus musculus]
                                  ATCATTGAACAGCAGGACTGAGCAG[
                                  -/CAGGACTGAGCAG
                                  ]AGATCTGCAGTGAGCGCCGGATTCC
                                  Chromosome:
                                  4:149696553
                                  Gene:
                                  Pik3cd (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  no info
                                  17.

                                  rs387018096 [Mus musculus]
                                    AGGGACAGGTCCCATTCAGGGGACT[A/G/T]TCTGGTCTATTCCAAGATGTCCTTC
                                    Chromosome:
                                    4:149700019
                                    Gene:
                                    Pik3cd (GeneView)
                                    Functional Consequence:
                                    intron variant,upstream variant 2KB
                                    Validated:
                                    no info
                                    18.

                                    rs386973891 [Mus musculus]
                                      TCTAGGCCTCGTTTTTTTTTTGTGT[
                                      -/GTGTGTANGT
                                      ]CCCTGTGCATTCTTTTCTTTGGCTG
                                      Chromosome:
                                      4:149685919
                                      Gene:
                                      Pik3cd (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      19.

                                      rs386954721 [Mus musculus]
                                        GCCCACCAGTCCAATTTTTTTTTTT[-/T]AAGATTATAGTTATCTATGTGTGTG
                                        Chromosome:
                                        4:149689353
                                        Gene:
                                        Pik3cd (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        no info
                                        20.

                                        rs386935360 [Mus musculus]
                                          CATATACATAAATCTTTTTTTTTTT[-/T]AATTCTTAAAAAAATTAGCAAAATG
                                          Chromosome:
                                          4:149656238
                                          Gene:
                                          Mir7023 (GeneView) Pik3cd (GeneView)
                                          Functional Consequence:
                                          intron variant,upstream variant 2KB
                                          Validated:
                                          no info

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center