Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 1956

1.

rs796653050 [Homo sapiens]
    AGGCTTCGTCCTGCTGAGAGTAGCC[A/T]CAGGTTTTTCTCAAATTCCTATCTT
    Chromosome:
    15:42736094
    Gene:
    CDAN1 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    no info
    HGVS:
    CM000677.2:g.42736094A>T, NC_000015.10:g.42736094A>T, NC_000015.9:g.43028292A>T, NG_012491.1:g.6126T>A, NM_138477.2:c.570-16T>A, NM_138477.3:c.570-16T>A, XR_001751104.1:n.624-13T>A, XR_001751105.1:n.624-13T>A, XR_931757.2:n.625-13T>A
    5.

    rs781767353 [Homo sapiens]
      GCTTCCTCCAGCCTCCCTGTCCCCG[C/T]CCCCAACCCCCCCTCATTTTCCCCA
      Chromosome:
      15:42729179
      Gene:
      CDAN1 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      CM000677.2:g.42729179C>T, NC_000015.10:g.42729179C>T, NC_000015.9:g.43021377C>T, NG_012491.1:g.13041G>A, NM_138477.2:c.2541+50G>A, NM_138477.3:c.2541+50G>A, XR_001751104.1:n.2598+50G>A, XR_001751105.1:n.2598+50G>A
      9.

      rs781600101 [Homo sapiens]
        AAATACAGCAGGAACGTTAGGAACT[A/G]CAGGGTCATGCTGAGAAAACTTCTC
        Chromosome:
        15:42734076
        Gene:
        CDAN1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        HGVS:
        CM000677.2:g.42734076G>A, NC_000015.10:g.42734076G>A, NC_000015.9:g.43026274G>A, NG_012491.1:g.8144C>T, NM_138477.2:c.1258-29C>T, NM_138477.3:c.1258-29C>T, XR_001751104.1:n.1315-29C>T, XR_001751105.1:n.1315-29C>T, XR_931757.2:n.1316-29C>T
        12.

        rs781484571 [Homo sapiens]
          GAAGATCCCCCACAGCGAGGAAACC[C/G]ATATCCCCAGGAGCGGCCAGGCCAT
          Chromosome:
          15:42735847
          Gene:
          CDAN1 (GeneView)
          Functional Consequence:
          intron variant,upstream variant 2KB
          Validated:
          no info
          HGVS:
          CM000677.2:g.42735847G>C, NC_000015.10:g.42735847G>C, NC_000015.9:g.43028045G>A, NC_000015.9:g.43028045G>C, NG_012491.1:g.6373C>G, NG_012491.1:g.6373C>T, NM_138477.2:c.773+28C>G, NM_138477.2:c.773+28C>T, NM_138477.3:c.773+28C>G, XR_001751104.1:n.830+28C>G, XR_001751105.1:n.830+28C>G, XR_931757.2:n.831+28C>G
          13.

          rs781410752 [Homo sapiens]
            TCTAACTCCTGGACTCAAGTAGTCC[C/T]CTCTCTCGGCTTCCCAAAGCACTGG
            Chromosome:
            15:42723078
            Gene:
            CDAN1 (GeneView)
            Functional Consequence:
            downstream variant 500B
            Validated:
            no info
            HGVS:
            CM000677.2:g.42723078T>C, NC_000015.10:g.42723078T>C, NC_000015.9:g.43015276T>C, NG_012491.1:g.19142A>G, NM_138477.2:c.*1413A>G, NM_138477.3:c.*1413A>G, XR_001751104.1:n.5090A>G, XR_001751105.1:n.5107A>G
            14.

            rs781407704 [Homo sapiens]
              GCGACTGCGCAGGCGCCGGCGCGCC[A/G]CGGGCGGCCAGGGAGGGGCGGGGCC
              Chromosome:
              15:42737148
              Gene:
              CDAN1 (GeneView)
              Functional Consequence:
              upstream variant 2KB,utr variant 5 prime
              Validated:
              no info
              HGVS:
              CM000677.2:g.42737148G>A, NC_000015.10:g.42737148G>A, NC_000015.9:g.43029346G>A, NG_012491.1:g.5072C>T, NM_138477.2:c.-46C>T, NM_138477.3:c.-46C>T, XR_001751104.1:n.-16C>T, XR_001751105.1:n.-16C>T, XR_931757.2:n.-15C>T
              17.

              rs781326760 [Homo sapiens]
                ACCAAGCTGTCAGTTAAGAACGGTC[C/T]CGTTTCTAGACCCCATGTCTCAAAA
                Chromosome:
                15:42735217
                Gene:
                CDAN1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                no info
                HGVS:
                CM000677.2:g.42735217C>T, NC_000015.10:g.42735217C>T, NC_000015.9:g.43027415C>T, NG_012491.1:g.7003G>A, NM_138477.2:c.1058-39G>A, NM_138477.3:c.1058-39G>A, XR_001751104.1:n.1115-39G>A, XR_001751105.1:n.1115-39G>A, XR_931757.2:n.1116-39G>A
                20.

                Display Settings:

                Format
                Items per page
                Sort by

                Send to:

                Choose Destination

                Supplemental Content

                Find related data

                Recent activity

                Your browsing activity is empty.

                Activity recording is turned off.

                Turn recording back on

                See more...
                Support Center