Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 1759

1.

rs796966847 [Homo sapiens]
    TAATCCCAGCTACTTGGGAGGCTGA[C/G]GCAGGAGAATCACTTGAACCCGGGA
    Chromosome:
    17:44056894
    Gene:
    LSM12 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    HGVS:
    NC_000017.10:g.42134262G>C, NC_000017.11:g.44056894G>C, NM_152344.3:c.258+6907C>G, XM_011524309.2:c.259-3336C>G
    2.

    rs796939215 [Homo sapiens]
      CTCTGTCTCTTTAAAAAAAAAAAAA[-/A]CAAACACACACACACACACACACAC
      Chromosome:
      17:44041287
      Gene:
      LSM12 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000017.10:g.42118655delA, NC_000017.11:g.44041287delA, NM_152344.3:c.259-1031delT
      3.

      rs796758030 [Homo sapiens]
        CACACACACACACACACACACACAC[-/AA]ACACACACACACACACAGAATTTCC
        Chromosome:
        17:44041333
        Gene:
        LSM12 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by cluster
        HGVS:
        NC_000017.10:g.42118701_42118702delAA, NC_000017.11:g.44041333_44041334delAA, NM_152344.3:c.259-1078_259-1077delTT
        4.

        rs796661834 [Homo sapiens]
          AGTTCAAGACCAGCCTGACCAACAC[CA/TG]AGAAACCCCATCTCTGCTAAAAATA
          Chromosome:
          17:44056085
          Gene:
          LSM12 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          no info
          HGVS:
          NC_000017.10:g.42133453_42133454delCAinsTG, NC_000017.11:g.44056085_44056086delCAinsTG, NM_152344.3:c.258+7715_258+7716delTGinsCA, XM_011524309.2:c.259-2528_259-2527delTGinsCA
          5.

          rs796551016 [Homo sapiens]
            AATCTTGCTTTCCAAACAATGCCTT[-/AAG]AAAATCTGAAGTCGGCCAGCGCTGT
            Chromosome:
            17:44043672
            Gene:
            LSM12 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by frequency
            HGVS:
            NC_000017.10:g.42121040_42121042delAAG, NC_000017.11:g.44043672_44043674delAAG, NM_152344.3:c.259-3418_259-3416delCTT
            6.

            rs796340351 [Homo sapiens]
              ACAGGCTGAGTAACAATGACACACT[A/G]GTTATAGAACAATGATTTCAAAATA
              Chromosome:
              17:44044311
              Gene:
              LSM12 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              HGVS:
              NC_000017.10:g.42121679G>A, NC_000017.11:g.44044311G>A, NM_152344.3:c.259-4055C>T
              7.

              rs796285081 [Homo sapiens]
                TTGGGAGGCTGAGGTGGGAGGATCA[C/T]TTGAGGCCAGGAGTTTGAGACCAGC
                Chromosome:
                17:44056385
                Gene:
                LSM12 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by frequency
                HGVS:
                NC_000017.10:g.42133753C>T, NC_000017.11:g.44056385C>T, NM_152344.3:c.258+7416G>A, XM_011524309.2:c.259-2827G>A
                8.

                rs796264719 [Homo sapiens]
                  ATTCTCCTACTCCCCACTTCCATGT[A/C]CTATAAGGCCAAGAAGGTCCCCTTG
                  Chromosome:
                  17:44054114
                  Gene:
                  LSM12 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by cluster
                  HGVS:
                  NC_000017.10:g.42131482C>A, NC_000017.11:g.44054114C>A, NM_152344.3:c.258+9687G>T, XM_011524309.2:c.259-556G>T
                  9.

                  rs796239657 [Homo sapiens]
                    AAGGAAAACTCCTCTCCAAAAAAAG[-/A]AAAAAAAAAAAATACAGCCTGGTAC
                    Chromosome:
                    17:44056700
                    Gene:
                    LSM12 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    HGVS:
                    NC_000017.10:g.42134068_42134069insA, NC_000017.11:g.44056700_44056701insA, NM_152344.3:c.258+7100_258+7101insT, XM_011524309.2:c.259-3143_259-3142insT
                    10.

                    rs796208842 [Homo sapiens]
                      GTCAAACTGTTTTCTTTTTTTTTTT[C/T]TTTTTTTTTTTTTTTTGCTGGAGTG
                      Chromosome:
                      17:44046759
                      Gene:
                      LSM12 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by cluster
                      HGVS:
                      NC_000017.10:g.42124127C>T, NC_000017.11:g.44046759C>T, NM_152344.3:c.259-6503G>A
                      11.

                      rs796076638 [Homo sapiens]
                        TTTTTTTTTTTTTTTTTTTTGAGAC[A/G]GAGTCTCGCTCTGTCGCCCAGGCCG
                        Chromosome:
                        17:44039398
                        Gene:
                        LSM12 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        NC_000017.10:g.42116766G>A, NC_000017.11:g.44039398G>A, NM_152344.3:c.368+749C>T
                        12.

                        rs781531050 [Homo sapiens]
                          GAAGGAGAAGACAGCAGGCGAAATG[C/T]AACCTCTTGGGGGCATCCCACATCT
                          Chromosome:
                          17:44037567
                          Gene:
                          LSM12 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          no info
                          HGVS:
                          NC_000017.10:g.42114935T>C, NC_000017.11:g.44037567T>C, NM_152344.3:c.369-29A>G
                          13.

                          rs781438366 [Homo sapiens]
                            TATGAGCAAGATGTCTGCATGGTTG[A/G]GCTTTCCACTGGAAGAGGGACATTC
                            Chromosome:
                            17:44063910
                            Gene:
                            LSM12 (GeneView)
                            Functional Consequence:
                            missense
                            Validated:
                            no info
                            HGVS:
                            NC_000017.10:g.42141278G>A, NC_000017.11:g.44063910G>A, NM_152344.3:c.149C>T, NP_689557.1:p.Pro50Leu, XM_011524309.2:c.149C>T, XP_011522611.1:p.Pro50Leu
                            14.

                            rs781425654 [Homo sapiens]
                              CTGAGTCTAACAATGCTGCAGCACA[C/T]GTGCAAACACGCGCGAGAACACACA
                              Chromosome:
                              17:44041937
                              Gene:
                              LSM12 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              no info
                              HGVS:
                              NC_000017.10:g.42119305T>C, NC_000017.11:g.44041937T>C, NM_152344.3:c.259-1681A>G
                              15.

                              rs781257725 [Homo sapiens]
                                GACCATTTGTGCCTCCAAACAGTCC[C/T]GTAACAAATGGTTCTATGTATGTGA
                                Chromosome:
                                17:44034388
                                Gene:
                                LSM12 (GeneView)
                                Functional Consequence:
                                downstream variant 500B
                                Validated:
                                no info
                                HGVS:
                                NC_000017.10:g.42111756T>C, NC_000017.11:g.44034388T>C, NM_152344.3:c.*1820A>G
                                16.

                                rs781209619 [Homo sapiens]
                                  TGCTGGAAGAGTCCTCCATGTGTAC[A/G]GACTCAGGATGACAGGGCAGCCTCC
                                  Chromosome:
                                  17:44036204
                                  Gene:
                                  LSM12 (GeneView)
                                  Functional Consequence:
                                  utr variant 3 prime
                                  Validated:
                                  by cluster,by frequency
                                  HGVS:
                                  NC_000017.10:g.42113572G>A, NC_000017.11:g.44036204G>A, NM_152344.3:c.*4C>T
                                  17.

                                  rs781179298 [Homo sapiens]
                                    AGGGAAGGATACTTAAAGCCAGCAT[C/T]TTGGATTGGTAGTCAAAGGCTACCA
                                    Chromosome:
                                    17:44066477
                                    Gene:
                                    LSM12 (GeneView)
                                    Functional Consequence:
                                    synonymous codon
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000017.10:g.42143845T>C, NC_000017.11:g.44066477T>C, NG_015818.1:g.748T>C, NM_152344.3:c.111A>G, NP_689557.1:p.Lys37, XM_011524309.2:c.111A>G, XP_011522611.1:p.Lys37
                                    18.

                                    rs780895280 [Homo sapiens]
                                      GATAGAGCCATGGCACTCCAGCCTG[A/G]GCAACAGAGTAAGACTTTTTTTTTC
                                      Chromosome:
                                      17:44057132
                                      Gene:
                                      LSM12 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000017.10:g.42134500G>A, NC_000017.11:g.44057132G>A, NM_152344.3:c.258+6669C>T, XM_011524309.2:c.259-3574C>T
                                      19.

                                      rs780739606 [Homo sapiens]
                                        CAAAGAAGTGAGACTCTGTCTCTTT[-/AAAAAAA]AAAAAAACAAACACACACACACACA
                                        Chromosome:
                                        17:44041274
                                        Gene:
                                        LSM12 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by cluster
                                        HGVS:
                                        NC_000017.10:g.42118642_42118648delAAAAAAA, NC_000017.11:g.44041274_44041280delAAAAAAA, NM_152344.3:c.259-1024_259-1018delTTTTTTT
                                        20.

                                        rs780610490 [Homo sapiens]
                                          TATAACCAAGAGCCCTGCTAATAGG[C/T]TATGTCCACAAACATAGGCCACAAT
                                          Chromosome:
                                          17:44055795
                                          Gene:
                                          LSM12 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000017.10:g.42133163C>T, NC_000017.11:g.44055795C>T, NM_152344.3:c.258+8006G>A, XM_011524309.2:c.259-2237G>A

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center