Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 806

1.

rs796824729 [Homo sapiens]
    GTGAGTGTGCACACACGCACACATG[-/CA]CACACACACACATGCATGCACACAC
    Chromosome:
    17:74916892
    Gene:
    USH1G (GeneView)
    Functional Consequence:
    utr variant 3 prime
    Clinical significance:
    Likely benign
    Validated:
    no info
    Global MAF:
    -=0.0461/231
    HGVS:
    NC_000017.10:g.72912984_72912985delCA, NC_000017.11:g.74916892_74916893delCA, NG_007882.1:g.11367_11368delTG, NM_001282489.2:c.*1180_*1181delTG, NM_173477.3:c.*1183_*1184delTG, NM_173477.4:c.*1180_*1181delTG, XM_005257026.1:c.*1183_*1184delTG, XM_011524296.2:c.*1180_*1181delTG
    2.

    rs796791712 [Homo sapiens]
      ACCAGCCTGGCCAACATGGCAAAAC[C/T]CCATCTCTACTAAAAATACAGAAAT
      Chromosome:
      17:74918643
      Gene:
      USH1G (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000017.10:g.72914738C>T, NC_000017.11:g.74918643C>T, NG_007882.1:g.9614G>A, NM_001282489.2:c.1074-567G>A, NM_173477.3:c.1383-567G>A, NM_173477.4:c.1383-567G>A, XM_005257026.1:c.1074-567G>A, XM_011524296.2:c.1074-567G>A
      4.

      rs796175661 [Homo sapiens]
        GAAGTGGGCTGCAGTTAGGGAAAAA[G/T]AGGAAGGTAAGGGGTCCTGGGGGAG
        Chromosome:
        17:74925108
        Gene:
        OTOP2 (GeneView) USH1G (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Validated:
        no info
        HGVS:
        NC_000017.10:g.72921203G>T, NC_000017.11:g.74925108G>T, NG_007882.1:g.3149C>A, NG_033062.1:g.5834G>T, NM_001282489.2:c.-2291C>A, NM_173477.4:c.-2035C>A, NM_178160.2:c.313+163G>T, XM_005257026.1:c.-2291C>A, XM_011525479.1:c.313+163G>T
        6.
        7.
        8.
        9.

        rs781098215 [Homo sapiens]
          GCGATGATGCTGCTGGCAACGCTCT[C/G]GATCCTCTTCTACCTCCTCCGAACC
          Chromosome:
          17:74924859
          Gene:
          OTOP2 (GeneView) USH1G (GeneView)
          Functional Consequence:
          missense,upstream variant 2KB
          Validated:
          no info
          HGVS:
          NC_000017.10:g.72920954G>C, NC_000017.11:g.74924859G>C, NG_007882.1:g.3398C>G, NG_033062.1:g.5585G>C, NM_001282489.2:c.-2042C>G, NM_173477.4:c.-1786C>G, NM_178160.2:c.227G>C, NP_835454.1:p.Trp76Ser, XM_005257026.1:c.-2042C>G, XM_011524296.2:c.-2429C>G, XM_011525479.1:c.227G>C, XP_011523781.1:p.Trp76Ser
          11.
          12.
          13.
          14.

          rs780531091 [Homo sapiens]
            GTCCGCTCCTCCCCTACAGTGATCC[A/C]TCTAGCCTTCTCCAGTCGCCTCCGC
            Chromosome:
            17:74924606
            Gene:
            OTOP2 (GeneView) USH1G (GeneView)
            Functional Consequence:
            upstream variant 2KB,utr variant 5 prime
            Validated:
            by frequency
            HGVS:
            NC_000017.10:g.72920701C>A, NC_000017.11:g.74924606C>A, NG_007882.1:g.3651G>T, NG_033062.1:g.5332C>A, NM_001282489.2:c.-1789G>T, NM_173477.4:c.-1533G>T, NM_178160.2:c.-27C>A, XM_005257026.1:c.-1789G>T, XM_011524296.2:c.-2176G>T, XM_011525479.1:c.-27C>A
            16.
            17.

            rs780126788 [Homo sapiens]
              GATGGAAGGGGACCTCTTTGCCCCC[A/G]GTCTGAAGATTAGAGAAGGCTGGCT
              Chromosome:
              17:74925172
              Gene:
              OTOP2 (GeneView) USH1G (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              no info
              HGVS:
              NC_000017.10:g.72921267G>A, NC_000017.11:g.74925172G>A, NG_007882.1:g.3085C>T, NG_033062.1:g.5898G>A, NM_001282489.2:c.-2355C>T, NM_173477.4:c.-2099C>T, NM_178160.2:c.313+227G>A, XM_005257026.1:c.-2355C>T, XM_011525479.1:c.313+227G>A
              18.

              rs779894692 [Homo sapiens]
                GCAGGCAGGGCCCTGTCTGCAGGGA[G/T]CAGGGCCAGCCCTGGCAAGCCCGAG
                Chromosome:
                17:74921215
                Gene:
                OTOP2 (GeneView) USH1G (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB
                Validated:
                by cluster
                HGVS:
                NC_000017.10:g.72917310G>T, NC_000017.11:g.74921215G>T, NG_007882.1:g.7042C>A, NG_033062.1:g.1941G>T, NM_001282489.2:c.-92-597C>A, NM_173477.3:c.165-544C>A, NM_173477.4:c.165-544C>A, XM_005257026.1:c.-92-597C>A, XM_011524296.2:c.-145-544C>A, XM_011525479.1:c.-2050G>T
                19.

                rs779827463 [Homo sapiens]
                  TCTGGGGAGAGGAGCCCCCGGTTAT[C/G]TGTGGAGGAAGAGACAGAAAGAAAC
                  Chromosome:
                  17:74918077
                  Gene:
                  USH1G (GeneView)
                  Functional Consequence:
                  splice acceptor variant
                  Validated:
                  no info
                  HGVS:
                  NC_000017.10:g.72914172C>G, NC_000017.11:g.74918077C>G, NG_007882.1:g.10180G>C, NM_001282489.2:c.1074-1G>C, NM_173477.3:c.1383-1G>C, NM_173477.4:c.1383-1G>C, XM_005257026.1:c.1074-1G>C, XM_011524296.2:c.1074-1G>C
                  20.

                  rs779773298 [Homo sapiens]
                    TTCGCGCTGCTCACTGCGATGATGC[C/T]GCTGGCAACGCTCTGGATCCTCTTC
                    Chromosome:
                    17:74924844
                    Gene:
                    OTOP2 (GeneView) USH1G (GeneView)
                    Functional Consequence:
                    missense,upstream variant 2KB
                    Validated:
                    by frequency
                    HGVS:
                    NC_000017.10:g.72920939T>C, NC_000017.11:g.74924844T>C, NG_007882.1:g.3413A>G, NG_033062.1:g.5570T>C, NM_001282489.2:c.-2027A>G, NM_173477.4:c.-1771A>G, NM_178160.2:c.212T>C, NP_835454.1:p.Leu71Pro, XM_005257026.1:c.-2027A>G, XM_011524296.2:c.-2414A>G, XM_011525479.1:c.212T>C, XP_011523781.1:p.Leu71Pro

                    Display Settings:

                    Format
                    Items per page
                    Sort by

                    Send to:

                    Choose Destination

                    Supplemental Content

                    Find related data

                    Recent activity

                    Your browsing activity is empty.

                    Activity recording is turned off.

                    Turn recording back on

                    See more...
                    Support Center