Display Settings:

Format

Send to:

Choose Destination

Links from ClinVar

1.

rs231775 [Homo sapiens]
    GCACAAGGCTCAGCTGAACCTGGCT[A/G/T]CCAGGACCTGGCCCTGCACTCTCCT
    Chromosome:
    2:203867991
    Gene:
    CTLA4 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    G=0.4273/2140
    HGVS:
    NC_000002.11:g.204732714A>G, NC_000002.12:g.203867991A>G, NG_011502.1:g.5206A>G, NM_001037631.2:c.49A>G, NM_005214.4:c.49A>G, NP_001032720.1:p.Thr17Ala, NP_005205.2:p.Thr17Ala, XR_241294.1:n.189A>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center