Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 1 to 20 of 37

1.

rs16901979 [Homo sapiens]
    GTGTTAATGATTTAGCATTACTTAT[A/C]TCTGGCAAATGGTATTTTTGAGATA
    Chromosome:
    8:127112671
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2119/1061
    HGVS:
    NC_000008.10:g.128124916C>A, NC_000008.11:g.127112671C>A
    2.

    rs16901896 [Homo sapiens]
      TTTCTTAAAACAAGGTAACTGAAAG[A/G]TCAAACTACCATCTAGAAATATAAG
      Chromosome:
      8:126998523
      Gene:
      LOC105375751 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.1186/594
      HGVS:
      NC_000008.10:g.128010768A>G, NC_000008.11:g.126998523A>G, XR_001746076.1:n.1361-8032A>G
      3.

      rs13254738 [Homo sapiens]
        CTCCTCATGGCCTCCTGCAGAATGC[A/C]ATTCTAAAATTAGGTTCTATTTTCC
        Chromosome:
        8:127092098
        Gene:
        PRNCR1 (GeneView)
        Functional Consequence:
        nc transcript variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.4675/2341
        HGVS:
        NC_000008.10:g.128104343C>A, NC_000008.11:g.127092098C>A, NR_109833.1:n.12225C>A, XR_242446.1:n.166-4591G>T
        4.

        rs12771728 [Homo sapiens]
          CCAGATGGCTATTCTAGGATGGCCA[C/T]GGATAGAATTCAGCTCTGCTCCATG
          Chromosome:
          10:87595556
          Gene:
          LOC105378412 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          C=0.2388/1196
          HGVS:
          NC_000010.10:g.89355313T>C, NC_000010.11:g.87595556T>C, XR_946171.2:n.-893T>C
          5.

          rs12418451 [Homo sapiens]
            GAAGCGGGAATCTGAGAGAGTTGCC[A/G]GGGCAAAATGTAGGCCCCCAGCCCC
            Chromosome:
            11:69167951
            Gene:
            LOC105369366 (GeneView) LOC338694 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.1288/645
            HGVS:
            NC_000011.10:g.69167951G>A, NC_000011.9:g.68935419G>A, NR_104161.1:n.475+378C>T, XR_247248.1:n.475+378C>T, XR_950255.2:n.108+1043G>A, XR_950256.2:n.108+1043G>A, XR_951787.2:n.108+1043G>A, XR_951788.2:n.108+1043G>A
            8.

            rs10896449 [Homo sapiens]
              CAGTTTAACTTTACAGGAGCTGAAA[A/G]TTTAAGAAGGGGAATGTCAAGAGAT
              Chromosome:
              11:69227200
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.4117/2062
              HGVS:
              NC_000011.10:g.69227200A>G, NC_000011.9:g.68994667A>G, NT_187582.1:g.65563A>G
              9.

              rs10486567 [Homo sapiens]
                ACATGCTTGCTGACTCTAAGTTTAA[A/G]TATCCCATTACACAGCAAGTTAAAT
                Chromosome:
                7:27936944
                Gene:
                JAZF1 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                A=0.4243/2125
                HGVS:
                NC_000007.13:g.27976563G>A, NC_000007.14:g.27936944G>A, NG_011499.1:g.248875C>T, NM_175061.3:c.189-41528C>T, XM_006715656.1:c.-66-23491C>T, XM_017011831.1:c.-4-41528C>T, XM_017011832.1:c.-4-41528C>T
                10.

                rs10090154 [Homo sapiens]
                  aatctctgcaagatttttttgtaaa[C/T]atAGCTAAAACAATATTGGAAAAAA
                  Chromosome:
                  8:127519892
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.1356/679
                  HGVS:
                  NC_000008.10:g.128532137T>C, NC_000008.11:g.127519892T>C
                  11.

                  rs10086908 [Homo sapiens]
                    TGATGAAATGAAACCAGTGGTGTGA[C/T]AGGGGAAGTTTGAGGTGATAGAAGA
                    Chromosome:
                    8:126999692
                    Gene:
                    LOC105375751 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.2682/1343
                    HGVS:
                    NC_000008.10:g.128011937T>C, NC_000008.11:g.126999692T>C, XR_001746076.1:n.1361-6863T>C
                    12.

                    rs9623117 [Homo sapiens]
                      CTCTCCCTGTTACTCTTAAGTAGTG[C/T]CTCCTTTCCCCATCCACCCCATCTC
                      Chromosome:
                      22:40056115
                      Gene:
                      TNRC6B (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                      Global MAF:
                      C=0.3624/1815
                      HGVS:
                      NC_000022.10:g.40452119T>C, NC_000022.11:g.40056115T>C, NM_001024843.1:c.-121+11117T>C, XM_005261393.1:c.-121+11117T>C, XM_005261394.1:c.-121+10527T>C
                      13.

                      rs9364554 [Homo sapiens]
                        CTATGATTAGTCCATCCTTGTCACT[C/T]TTTGAGTGAACACATTTGAGCTGTG
                        Chromosome:
                        6:160412632
                        Gene:
                        SLC22A3 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        T=0.2101/1052
                        HGVS:
                        NC_000006.11:g.160833664C>T, NC_000006.12:g.160412632C>T, NM_021977.3:c.975+1786C>T, XM_005267106.1:c.582+1786C>T, XM_005267106.4:c.582+1786C>T, XM_005267107.1:c.975+1786C>T, XM_005267107.3:c.975+1786C>T, XM_011536075.2:c.519+1786C>T, XM_011536076.2:c.519+1786C>T, XM_017011203.1:c.519+1786C>T, XR_001743588.1:n.1017+1786C>T, XR_001743589.1:n.1017+1786C>T, XR_245546.1:n.1017+1786C>T
                        14.

                        rs7931342 [Homo sapiens]
                          CAGGATCAGGGAAGTTGCCCTGAAG[G/T]TGATAAGCAGAATGTGGAAGGATGG
                          Chromosome:
                          11:69227030
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                          Global MAF:
                          T=0.4876/2442
                          HGVS:
                          NC_000011.10:g.69227030T>G, NC_000011.9:g.68994497T>G, NT_187582.1:g.65393T>G
                          15.

                          rs7920517 [Homo sapiens]
                            TTCTAATACCATTTTCACTTCTCCC[A/G]AATTTTGTGGATCGTTTCTTGGTAT
                            Chromosome:
                            10:46063201
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.4253/2130
                            HGVS:
                            NC_000010.10:g.51532621G>A, NC_000010.11:g.46063201C>T, NG_010857.1:g.52C>T, NM_001290117.1:c.514+144858G>A, NM_001290118.1:c.370+144858G>A, NW_003871068.1:g.334316C>T, XM_003118952.4:c.514+144858G>A, XM_005270305.1:c.370+144858G>A
                            16.

                            rs7904463 [Homo sapiens]
                              ACCTTCTTCCCTGGAATTGCCTCAC[C/T]TCCTTTGTTTTTCTCATGAACTTTT
                              Chromosome:
                              10:46036353
                              Gene:
                              MSMB (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              T=0.4367/2187
                              HGVS:
                              NC_000010.10:g.51559469C>T, NC_000010.11:g.46036353G>A, NG_011551.1:g.14917C>T, NM_001290117.1:c.514+171706C>T, NM_001290118.1:c.370+171706C>T, NM_002443.3:c.215+2613C>T, NM_138634.2:c.110-2802C>T, NW_003871068.1:g.307468G>A, XM_003118952.4:c.514+171706C>T, XM_005270305.1:c.370+171706C>T
                              18.
                              19.

                              rs7000448 [Homo sapiens]
                                ATACTGGGCTAGAGCAGAGGAGCAG[C/T]ATTTTTGAGAATCTGGCCAATATGG
                                Chromosome:
                                8:127428925
                                Gene:
                                CASC8 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                Global MAF:
                                T=0.4129/2068
                                HGVS:
                                NC_000008.10:g.128441170C>T, NC_000008.11:g.127428925C>T, NR_117100.1:n.1042-7962G>A
                                20.

                                rs6983561 [Homo sapiens]
                                  TGCAAACTAATAGAACATATAGCAC[A/C]AAATGATTATATCAATAGAATGCTA
                                  Chromosome:
                                  8:127094635
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.2173/1088
                                  HGVS:
                                  NC_000008.10:g.128106880A>C, NC_000008.11:g.127094635A>C, XR_242446.1:n.166-7128T>G

                                  Display Settings:

                                  Format
                                  Items per page
                                  Sort by

                                  Send to:

                                  Choose Destination

                                  Supplemental Content

                                  Find related data

                                  Recent activity

                                  Your browsing activity is empty.

                                  Activity recording is turned off.

                                  Turn recording back on

                                  See more...
                                  Support Center