Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 234

1.

rs781629621 [Homo sapiens]
    TGAGGAGACCCGCGGAGTGTTGAAG[A/G]TGTTCCTGGAGAACGTGATCCGGGA
    Chromosome:
    6:27139489
    Gene:
    HIST1H2BK (GeneView) HIST1H4I (GeneView)
    Functional Consequence:
    intron variant,missense
    Validated:
    no info
    HGVS:
    NC_000006.11:g.27107268G>A, NC_000006.12:g.27139489G>A, NM_003495.2:c.181G>A, NM_080593.2:c.*10-808C>T, NP_003486.1:p.Val61Met, XM_005249436.1:c.181G>A, XP_005249493.1:p.Val61Met
    2.

    rs781539533 [Homo sapiens]
      ACATCCAGGGTATCACCAAGCCAGC[C/T]ATTCGGCGCCTTGCTCGCCGCGGCG
      Chromosome:
      6:27139410
      Gene:
      HIST1H2BK (GeneView) HIST1H4I (GeneView)
      Functional Consequence:
      intron variant,synonymous codon
      Validated:
      no info
      HGVS:
      NC_000006.11:g.27107189C>T, NC_000006.12:g.27139410C>T, NM_003495.2:c.102C>T, NM_080593.2:c.*10-729G>A, NP_003486.1:p.Ala34, XM_005249436.1:c.102C>T, XP_005249493.1:p.Ala34
      3.

      rs780853367 [Homo sapiens]
        AGCCCAGTCATTCTCTAAAAAGGCC[C/G]TTTTTAGGGCCCCTAAGCTTTCAAC
        Chromosome:
        6:27139658
        Gene:
        HIST1H2BK (GeneView) HIST1H4I (GeneView)
        Functional Consequence:
        intron variant,utr variant 3 prime
        Validated:
        no info
        HGVS:
        NC_000006.11:g.27107437C>G, NC_000006.12:g.27139658C>G, NM_003495.2:c.*38C>G, NM_080593.2:c.*10-977G>C, XM_005249436.1:c.*38C>G
        4.

        rs780445663 [Homo sapiens]
          GACCCGCGGAGTGTTGAAGGTGTTC[C/T]TGGAGAACGTGATCCGGGACGCCGT
          Chromosome:
          6:27139495
          Gene:
          HIST1H2BK (GeneView) HIST1H4I (GeneView)
          Functional Consequence:
          intron variant,synonymous codon
          Validated:
          by frequency
          HGVS:
          NC_000006.11:g.27107274C>T, NC_000006.12:g.27139495C>T, NM_003495.2:c.187C>T, NM_080593.2:c.*10-814G>A, NP_003486.1:p.Leu63, XM_005249436.1:c.187C>T, XP_005249493.1:p.Leu63
          5.

          rs780353227 [Homo sapiens]
            CCAAGCGCAAGACGGTCACCGCCAT[A/G]GACGTGGTCTACGCGCTCAAGCGCC
            Chromosome:
            6:27139563
            Gene:
            HIST1H2BK (GeneView) HIST1H4I (GeneView)
            Functional Consequence:
            intron variant,missense
            Validated:
            no info
            HGVS:
            NC_000006.11:g.27107342G>A, NC_000006.12:g.27139563G>A, NM_003495.2:c.255G>A, NM_080593.2:c.*10-882C>T, NP_003486.1:p.Met85Ile, XM_005249436.1:c.255G>A, XP_005249493.1:p.Met85Ile
            6.

            rs780090802 [Homo sapiens]
              TAAAAGAAAGCTGCCATCACAGGCA[C/G]CAGACCTTTGTTCTCTGACCACTTG
              Chromosome:
              6:27139280
              Gene:
              HIST1H2BK (GeneView) HIST1H4I (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              by frequency
              HGVS:
              NC_000006.11:g.27107059G>C, NC_000006.12:g.27139280G>C, NM_003495.2:c.-29G>C, NM_080593.2:c.*10-599C>G, XM_005249436.1:c.-1-28G>C
              7.

              rs779965916 [Homo sapiens]
                CTCTGACCACTTGATAATGTCAGGA[-/CG]CGCGGCAAAGGAGGTAAGGGCCTGG
                Chromosome:
                6:27139317
                Gene:
                HIST1H2BK (GeneView) HIST1H4I (GeneView)
                Functional Consequence:
                frameshift variant,intron variant
                Validated:
                by frequency
                HGVS:
                NC_000006.11:g.27107096_27107097insCG, NC_000006.12:g.27139317_27139318insCG, NM_003495.2:c.9_10insCG, NM_080593.2:c.*10-637_*10-636insCG, NP_003486.1:p.Gly5Alafs, XM_005249436.1:c.9_10insCG, XP_005249493.1:p.Gly5Alafs
                8.

                rs779964017 [Homo sapiens]
                  CTTGATAATGTCAGGACGCGGCAAA[A/G]GAGGTAAGGGCCTGGGGAAAGGGGG
                  Chromosome:
                  6:27139327
                  Gene:
                  HIST1H2BK (GeneView) HIST1H4I (GeneView)
                  Functional Consequence:
                  intron variant,missense
                  Validated:
                  no info
                  HGVS:
                  NC_000006.11:g.27107106G>A, NC_000006.12:g.27139327G>A, NM_003495.2:c.19G>A, NM_080593.2:c.*10-646C>T, NP_003486.1:p.Gly7Arg, XM_005249436.1:c.19G>A, XP_005249493.1:p.Gly7Arg
                  9.

                  rs779805718 [Homo sapiens]
                    GCGGGCACAGAGCTCTGCATGGGGG[A/G]GAGGGGGACAGACCATGCTTTTACT
                    Chromosome:
                    6:27140089
                    Gene:
                    HIST1H2BK (GeneView) HIST1H4I (GeneView)
                    Functional Consequence:
                    downstream variant 500B,intron variant
                    Validated:
                    by frequency
                    HGVS:
                    NC_000006.11:g.27107868G>A, NC_000006.12:g.27140089G>A, NM_003495.2:c.*469G>A, NM_080593.2:c.*10-1408C>T, XM_005249436.1:c.*469G>A
                    10.

                    rs779350495 [Homo sapiens]
                      CTGCTACTGGTGCAGGGGCCAAGAG[-/A]AAAACCTCCCTTTTGGCCTCTGAAA
                      Chromosome:
                      6:27138238
                      Gene:
                      HIST1H2BK (GeneView) HIST1H4I (GeneView)
                      Functional Consequence:
                      downstream variant 500B,upstream variant 2KB
                      Validated:
                      no info
                      HGVS:
                      NC_000006.11:g.27106017_27106018insA, NC_000006.12:g.27138238_27138239insA, NM_003495.2:c.-1071_-1070insA, NM_080593.2:c.*452_*453insT, XM_005249436.1:c.-928_-927insA
                      11.

                      rs779226325 [Homo sapiens]
                        CACCGCAAGGTGCTGCGCGACAACA[C/T]CCAGGGTATCACCAAGCCAGCCATT
                        Chromosome:
                        6:27139388
                        Gene:
                        HIST1H2BK (GeneView) HIST1H4I (GeneView)
                        Functional Consequence:
                        intron variant,missense
                        Validated:
                        no info
                        HGVS:
                        NC_000006.11:g.27107167T>C, NC_000006.12:g.27139388T>C, NM_003495.2:c.80T>C, NM_080593.2:c.*10-707A>G, NP_003486.1:p.Ile27Thr, XM_005249436.1:c.80T>C, XP_005249493.1:p.Ile27Thr
                        12.

                        rs779121479 [Homo sapiens]
                          GGCATTTTGAAGCCCAGTCATTCTC[A/C/T]AAAAAGGCCCTTTTTAGGGCCCCTA
                          Chromosome:
                          6:27139648
                          Gene:
                          HIST1H2BK (GeneView) HIST1H4I (GeneView)
                          Functional Consequence:
                          intron variant,utr variant 3 prime
                          Validated:
                          no info
                          HGVS:
                          NC_000006.11:g.27107427T>A, NC_000006.11:g.27107427T>C, NC_000006.12:g.27139648T>A, NC_000006.12:g.27139648T>C, NM_003495.2:c.*28T>A, NM_003495.2:c.*28T>C, NM_080593.2:c.*10-967A>G, NM_080593.2:c.*10-967A>T, XM_005249436.1:c.*28T>A, XM_005249436.1:c.*28T>C
                          13.

                          rs778931172 [Homo sapiens]
                            AGGTGCTGCGCGACAACATCCAGGG[-/T]TATCACCAAGCCAGCCATTCGGCGC
                            Chromosome:
                            6:27139394
                            Gene:
                            HIST1H2BK (GeneView) HIST1H4I (GeneView)
                            Functional Consequence:
                            frameshift variant,intron variant
                            Validated:
                            no info
                            HGVS:
                            NC_000006.11:g.27107173_27107174insT, NC_000006.12:g.27139394_27139395insT, NM_003495.2:c.86_87insT, NM_080593.2:c.*10-714_*10-713insA, NP_003486.1:p.Ile30Tyrfs, XM_005249436.1:c.86_87insT, XP_005249493.1:p.Ile30Tyrfs
                            14.

                            rs778762218 [Homo sapiens]
                              GTGGTGGCTGGTTTAAGAGGACTTG[A/G]CGGGCACAGAGCTCTGCATGGGGGG
                              Chromosome:
                              6:27140064
                              Gene:
                              HIST1H2BK (GeneView) HIST1H4I (GeneView)
                              Functional Consequence:
                              downstream variant 500B,intron variant
                              Validated:
                              no info
                              HGVS:
                              NC_000006.11:g.27107843G>A, NC_000006.12:g.27140064G>A, NM_003495.2:c.*444G>A, NM_080593.2:c.*10-1383C>T, XM_005249436.1:c.*444G>A
                              15.

                              rs777989743 [Homo sapiens]
                                TCACCAAGCCAGCCATTCGGCGCCT[-/A]TGCTCGCCGCGGCGGCGTGAAGCGC
                                Chromosome:
                                6:27139421
                                Gene:
                                HIST1H2BK (GeneView) HIST1H4I (GeneView)
                                Functional Consequence:
                                frameshift variant,intron variant
                                Validated:
                                no info
                                HGVS:
                                NC_000006.11:g.27107200_27107201insA, NC_000006.12:g.27139421_27139422insA, NM_003495.2:c.113_114insA, NM_080593.2:c.*10-741_*10-740insT, NP_003486.1:p.Ala39Cysfs, XM_005249436.1:c.113_114insA, XP_005249493.1:p.Ala39Cysfs
                                16.

                                rs777882267 [Homo sapiens]
                                  CTGCGCGACAACATCCAGGGTATCA[C/T]CAAGCCAGCCATTCGGCGCCTTGCT
                                  Chromosome:
                                  6:27139400
                                  Gene:
                                  HIST1H2BK (GeneView) HIST1H4I (GeneView)
                                  Functional Consequence:
                                  intron variant,missense
                                  Validated:
                                  no info
                                  HGVS:
                                  NC_000006.11:g.27107179C>T, NC_000006.12:g.27139400C>T, NM_003495.2:c.92C>T, NM_080593.2:c.*10-719G>A, NP_003486.1:p.Thr31Ile, XM_005249436.1:c.92C>T, XP_005249493.1:p.Thr31Ile
                                  17.

                                  rs777436970 [Homo sapiens]
                                    CGGTCACCGCCATGGACGTGGTCTA[C/T]GCGCTCAAGCGCCAGGGCCGCACCC
                                    Chromosome:
                                    6:27139575
                                    Gene:
                                    HIST1H2BK (GeneView) HIST1H4I (GeneView)
                                    Functional Consequence:
                                    intron variant,synonymous codon
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000006.11:g.27107354C>T, NC_000006.12:g.27139575C>T, NM_003495.2:c.267C>T, NM_080593.2:c.*10-894G>A, NP_003486.1:p.Tyr89, XM_005249436.1:c.267C>T, XP_005249493.1:p.Tyr89
                                    18.

                                    rs776957502 [Homo sapiens]
                                      GGCGGCTAAATGGCATTTTGAAGCC[-/CAGT]CATTCTCTAAAAAGGCCCTTTTTAG
                                      Chromosome:
                                      6:27139637
                                      Gene:
                                      HIST1H2BK (GeneView) HIST1H4I (GeneView)
                                      Functional Consequence:
                                      intron variant,utr variant 3 prime
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000006.11:g.27107416_27107419delCAGT, NC_000006.12:g.27139637_27139640delCAGT, NM_003495.2:c.*17_*20delCAGT, NM_080593.2:c.*10-959_*10-956delACTG, XM_005249436.1:c.*17_*20delCAGT
                                      19.

                                      rs776948616 [Homo sapiens]
                                        TACACGGAGCACGCCAAGCGCAAGA[C/T]GGTCACCGCCATGGACGTGGTCTAC
                                        Chromosome:
                                        6:27139550
                                        Gene:
                                        HIST1H2BK (GeneView) HIST1H4I (GeneView)
                                        Functional Consequence:
                                        intron variant,missense
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000006.11:g.27107329C>T, NC_000006.12:g.27139550C>T, NM_003495.2:c.242C>T, NM_080593.2:c.*10-869G>A, NP_003486.1:p.Thr81Met, XM_005249436.1:c.242C>T, XP_005249493.1:p.Thr81Met
                                        20.

                                        rs776747593 [Homo sapiens]
                                          TCCGGGACGCCGTGACCTACACGGA[A/G]CACGCCAAGCGCAAGACGGTCACCG
                                          Chromosome:
                                          6:27139533
                                          Gene:
                                          HIST1H2BK (GeneView) HIST1H4I (GeneView)
                                          Functional Consequence:
                                          intron variant,synonymous codon
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000006.11:g.27107312G>A, NC_000006.12:g.27139533G>A, NM_003495.2:c.225G>A, NM_080593.2:c.*10-852C>T, NP_003486.1:p.Glu75, XM_005249436.1:c.225G>A, XP_005249493.1:p.Glu75

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center