Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 3025

1.

rs796769562 [Homo sapiens]
    CACACACACACACACACACACACAC[-/GC]ACGCACACATCTTTAAAGCATTAAA
    Chromosome:
    X:43692039
    Gene:
    MAOA (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by cluster
    HGVS:
    NC_000023.10:g.43551287_43551288delGC, NC_000023.11:g.43692039_43692040delGC, NG_008957.2:g.40879_40880delGC, NM_000240.3:c.169-1252_169-1251delGC, NM_001270458.1:c.-231-1252_-231-1251delGC
    2.

    rs796181056 [Homo sapiens]
      CTTTACATCAGGCATAGTCTGTAGT[C/T]TAGCCAGTCTTTATTAAGCCTTTGT
      Chromosome:
      X:43711374
      Gene:
      MAOA (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000023.10:g.43570621C>T, NC_000023.11:g.43711374C>T, NG_008957.2:g.60214C>T, NM_000240.3:c.307-498C>T, NM_001270458.1:c.-93-498C>T
      3.

      rs796160408 [Homo sapiens]
        CAGACACACACACACACACACACAC[-/AC]TTAGATTCCCTATTTATCCAATGAC
        Chromosome:
        X:43683980
        Gene:
        MAOA (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        HGVS:
        NC_000023.10:g.43543228_43543229delAC, NC_000023.11:g.43683980_43683981delAC, NG_008957.2:g.32820_32821delAC, NM_000240.3:c.168+373_168+374delAC, NM_001270458.1:c.-232+373_-232+374delAC
        4.

        rs796065312 [Homo sapiens]
          CGTTAGTGTTTTGGTTTTAGAAGCT[C/T]GGGACAGGGTTGGAGGAAGAACATA
          Chromosome:
          X:43683572
          Gene:
          MAOA (GeneView)
          Functional Consequence:
          missense,utr variant 5 prime
          Clinical significance:
          Pathogenic
          Validated:
          no info
          HGVS:
          NC_000023.10:g.43542820C>T, NC_000023.11:g.43683572C>T, NG_008957.2:g.32412C>T, NM_000240.3:c.133C>T, NM_001270458.1:c.-267C>T, NP_000231.1:p.Arg45Trp
          5.

          rs796065311 [Homo sapiens]
            ATCCTGTCACTCACGTTGACCAGTC[-/T]AAGTGACAACATCATCATAGAGACG
            Chromosome:
            X:43731344
            Gene:
            MAOA (GeneView)
            Functional Consequence:
            frameshift variant
            Clinical significance:
            Pathogenic
            Validated:
            no info
            HGVS:
            NC_000023.10:g.43590591_43590592insT, NC_000023.11:g.43731344_43731345insT, NG_008957.2:g.80184_80185insT, NM_000240.3:c.749_750insT, NM_001270458.1:c.350_351insT, NP_000231.1:p.Ser251Lysfs, NP_001257387.1:p.Ser118Lysfs
            6.

            rs781764384 [Homo sapiens]
              TTTTATAAAGAACTTTGGTGTTGTT[A/T]TTAAAACAGTAGCCAGTTACAAAAG
              Chromosome:
              X:43729812
              Gene:
              MAOA (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              HGVS:
              NC_000023.10:g.43589059A>T, NC_000023.11:g.43729812A>T, NG_008957.2:g.78652A>T, NM_000240.3:c.646-1429A>T, NM_001270458.1:c.247-1429A>T
              7.

              rs781756525 [Homo sapiens]
                TTTAAGGTTGATATTGTTATGTGTG[-/A]AATTTGATCCTATCATTTTGATGCT
                Chromosome:
                X:43725696
                Gene:
                MAOA (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by cluster
                HGVS:
                NC_000023.10:g.43584943_43584944insA, NC_000023.11:g.43725696_43725697insA, NG_008957.2:g.74536_74537insA, NM_000240.3:c.504-2477_504-2476insA, NM_001270458.1:c.105-2477_105-2476insA
                8.

                rs781722252 [Homo sapiens]
                  CATTCTTGCCCGGAAAGCTGATCGA[C/G]TTGCTAAGCTACATAAGGAAATAAG
                  Chromosome:
                  X:43736255
                  Gene:
                  MAOA (GeneView)
                  Functional Consequence:
                  missense
                  Validated:
                  by frequency
                  HGVS:
                  NC_000023.10:g.43595502C>G, NC_000023.11:g.43736255C>G, NG_008957.2:g.85095C>G, NM_000240.3:c.1081C>G, NM_001270458.1:c.682C>G, NP_000231.1:p.Leu361Val, NP_001257387.1:p.Leu228Val
                  9.

                  rs781697714 [Homo sapiens]
                    TAATAAAAAGACAAACAACCCAATT[A/C]AAAAATGGACAAAGGACTTGAATAG
                    Chromosome:
                    X:43705783
                    Gene:
                    MAOA (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G
                    Global MAF:
                    A=0.0003/1
                    HGVS:
                    NC_000023.10:g.43565030C>A, NC_000023.11:g.43705783C>A, NG_008957.2:g.54623C>A, NM_000240.3:c.307-6089C>A, NM_001270458.1:c.-93-6089C>A
                    10.

                    rs781678736 [Homo sapiens]
                      TAATGTACCTATACATGTTTTACCT[C/G]ACTTGAGCTTCCCAATGGTCCTCAG
                      Chromosome:
                      X:43700172
                      Gene:
                      MAOA (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      HGVS:
                      NC_000023.10:g.43559419C>G, NC_000023.11:g.43700172C>G, NG_008957.2:g.49012C>G, NM_000240.3:c.306+6744C>G, NM_001270458.1:c.-94+6744C>G
                      11.

                      rs781653189 [Homo sapiens]
                        TTTAATTACACAAAAGCCGCCAGAA[A/G]AACTCATTATTGTTTCTATCTTAAC
                        Chromosome:
                        X:43706395
                        Gene:
                        MAOA (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        by 1000G,by cluster
                        Global MAF:
                        A=0.0003/1
                        HGVS:
                        NC_000023.10:g.43565642G>A, NC_000023.11:g.43706395G>A, NG_008957.2:g.55235G>A, NM_000240.3:c.307-5477G>A, NM_001270458.1:c.-93-5477G>A
                        12.

                        rs781649036 [Homo sapiens]
                          TTGCCTTACATATCTTTTCCAAAAA[A/T]TTTTAATTTTAAAGGGAAGAAGGGA
                          Chromosome:
                          X:43738308
                          Gene:
                          MAOA (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          A=0.0024/9
                          HGVS:
                          NC_000023.10:g.43597555T>A, NC_000023.11:g.43738308T>A, NG_008957.2:g.87148T>A, NM_000240.3:c.1106+2028T>A, NM_001270458.1:c.707+2028T>A
                          13.

                          rs781622470 [Homo sapiens]
                            AAAATAAATGTATGCACAATAGCAC[-/TA]TATATATATATATATTTTTTTTTTT
                            Chromosome:
                            X:43681865
                            Gene:
                            MAOA (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            no info
                            HGVS:
                            NC_000023.10:g.43541113_43541114delTA, NC_000023.11:g.43681865_43681866delTA, NG_008957.2:g.30705_30706delTA, NM_000240.3:c.74-1648_74-1647delTA, NM_001270458.1:c.-326-1648_-326-1647delTA
                            14.

                            rs781594824 [Homo sapiens]
                              TTCAGCTTTCTGGAGGGGAGAACTG[C/T]TCAACTCTACCATATTTTTATTTCA
                              Chromosome:
                              X:43696291
                              Gene:
                              MAOA (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G
                              Global MAF:
                              T=0.0003/1
                              HGVS:
                              NC_000023.10:g.43555538C>T, NC_000023.11:g.43696291C>T, NG_008957.2:g.45131C>T, NM_000240.3:c.306+2863C>T, NM_001270458.1:c.-94+2863C>T
                              15.

                              rs781568403 [Homo sapiens]
                                CAGCCTTGCATCCCAGGGATGAAGC[C/G]CACTTGATCATGGTGGATAAGCTTT
                                Chromosome:
                                X:43672794
                                Gene:
                                MAOA (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                G=0.0003/1
                                HGVS:
                                NC_000023.10:g.43532042C>G, NC_000023.11:g.43672794C>G, NG_008957.2:g.21634C>G, NM_000240.3:c.74-10719C>G, NM_001270458.1:c.-326-10719C>G
                                16.

                                rs781566747 [Homo sapiens]
                                  GCCTGGCTCAGCCGCCTTCATATAT[C/G]TGCTTCCTTAAGTCCACTCTTGCCC
                                  Chromosome:
                                  X:43654706
                                  Gene:
                                  MAOA (GeneView)
                                  Functional Consequence:
                                  upstream variant 2KB
                                  Validated:
                                  by 1000G,by cluster
                                  Global MAF:
                                  G=0.0003/1
                                  HGVS:
                                  NC_000023.10:g.43513954C>G, NC_000023.11:g.43654706C>G, NG_008957.2:g.3546C>G, NM_000240.3:c.-1636C>G, NM_001270458.1:c.-2143C>G
                                  17.

                                  rs781550796 [Homo sapiens]
                                    CCAGTTTTCCCAGCACCATTTATTA[A/T]ATAGGGAATCCTTTCCCCATTGCTT
                                    Chromosome:
                                    X:43671692
                                    Gene:
                                    MAOA (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by 1000G,by cluster,by frequency
                                    Global MAF:
                                    T=0.0342/129
                                    HGVS:
                                    NC_000023.10:g.43530940A>T, NC_000023.11:g.43671692A>T, NG_008957.2:g.20532A>T, NM_000240.3:c.74-11821A>T, NM_001270458.1:c.-326-11821A>T
                                    18.

                                    rs781545783 [Homo sapiens]
                                      AATGTCCTCGAAGAAACTCCCTTCC[A/G]TCTTCAAATTCTAATTGAAGGCAGC
                                      Chromosome:
                                      X:43686032
                                      Gene:
                                      MAOA (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G
                                      Global MAF:
                                      G=0.0003/1
                                      HGVS:
                                      NC_000023.10:g.43545280A>G, NC_000023.11:g.43686032A>G, NG_008957.2:g.34872A>G, NM_000240.3:c.168+2425A>G, NM_001270458.1:c.-232+2425A>G
                                      19.

                                      rs781531777 [Homo sapiens]
                                        TCTGCACCAGGCCAATGTTCTGGAA[A/G]CCTCTTCTGCGTCACTGTCCTAATA
                                        Chromosome:
                                        X:43664022
                                        Gene:
                                        MAOA (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by 1000G
                                        Global MAF:
                                        G=0.0003/1
                                        HGVS:
                                        NC_000023.10:g.43523270A>G, NC_000023.11:g.43664022A>G, NG_008957.2:g.12862A>G, NM_000240.3:c.73+7608A>G, NM_001270458.1:c.-327+6053A>G
                                        20.

                                        rs781530793 [Homo sapiens]
                                          ACTTTTGCAAAGTAGCCTTCTAACA[C/G]TTGAAATCTTAAACAGCCTCTAACG
                                          Chromosome:
                                          X:43702036
                                          Gene:
                                          MAOA (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          by 1000G,by cluster
                                          Global MAF:
                                          C=0.0003/1
                                          HGVS:
                                          NC_000023.10:g.43561283G>C, NC_000023.11:g.43702036G>C, NG_008957.2:g.50876G>C, NM_000240.3:c.306+8608G>C, NM_001270458.1:c.-94+8608G>C

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center