Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 1564

1.

rs864622631 [Homo sapiens]
    CACCGCTTCTCTTTGCAGGTCGAAA[G/T]GGGCAAGGACCCCCTTTTGTCCCTT
    Chromosome:
    11:62691272
    Gene:
    BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView) LRRN4CL (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Clinical significance:
    Likely benign
    Validated:
    no info
    HGVS:
    NC_000011.10:g.62691272C>A, NC_000011.9:g.62458744C>A, NG_008461.1:g.23303G>T, NG_033077.1:g.3628G>T, NM_001122955.3:c.1005+8G>T, NM_001130702.2:c.672-131G>T, NM_032667.6:c.813+8G>T, NM_203422.3:c.-1851G>T, NR_037946.1:n.3525+8G>T, NR_037948.1:n.1607+8G>T, NR_037949.1:n.1607+8G>T, XM_005273909.1:c.1005+8G>T
    2.

    rs796912815 [Homo sapiens]
      ACCTGTGGCGCATCACATTTTCCTG[C/G]ATATGGAAAATGGAGGGTCCCTGGG
      Chromosome:
      11:62707304
      Gene:
      BSCL2 (GeneView) GNG3 (GeneView) HNRNPUL2-BSCL2 (GeneView)
      Functional Consequence:
      nc transcript variant,upstream variant 2KB,utr variant 5 prime
      Validated:
      no info
      HGVS:
      NC_000011.10:g.62707304G>C, NC_000011.9:g.62474776G>C, NG_008461.1:g.7271C>G, NM_001122955.3:c.-109C>G, NM_001130702.2:c.-1207C>G, NM_012202.4:c.-613G>C, NM_032667.6:c.-1207C>G, NR_037946.1:n.2412C>G, NR_037948.1:n.494C>G, NR_037949.1:n.494C>G, XM_005273909.1:c.-109C>G, XM_006718500.2:c.-261G>C
      3.

      rs796763529 [Homo sapiens]
        GCACGAGAATTGCTTGAACCTGGGA[A/G]GTTGCAGTGAGCAGACACTGCACCA
        Chromosome:
        11:62704681
        Gene:
        BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        HGVS:
        NC_000011.10:g.62704681G>A, NC_000011.9:g.62472153G>A, NG_008461.1:g.9894C>T, NM_001122955.3:c.404+620C>T, NM_001130702.2:c.212+620C>T, NM_032667.6:c.212+620C>T, NR_037946.1:n.2924+620C>T, NR_037948.1:n.1006+620C>T, NR_037949.1:n.1006+620C>T, XM_005273909.1:c.404+620C>T
        4.

        rs796710127 [Homo sapiens]
          AAACTCCATCTCAAAAAAAAAAAAA[-/A]GGAAATTCCAGGGTCCCACCCCAAG
          Chromosome:
          11:62703164
          Gene:
          BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          no info
          HGVS:
          NC_000011.10:g.62703164delA, NC_000011.9:g.62470636delA, NG_008461.1:g.11411delT, NM_001122955.3:c.405-615delT, NM_001130702.2:c.213-615delT, NM_032667.6:c.213-615delT, NR_037946.1:n.2925-615delT, NR_037948.1:n.1007-615delT, NR_037949.1:n.1007-615delT, XM_005273909.1:c.405-615delT
          5.

          rs796613463 [Homo sapiens]
            AAAAAAAAAAATTCTGCTCACTTGG[C/G]TGGAGCCCTTAGCCCTGGATTTCTG
            Chromosome:
            11:62692086
            Gene:
            BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by frequency
            HGVS:
            NC_000011.10:g.62692086G>C, NC_000011.9:g.62459558G>C, NG_008461.1:g.22489C>G, NG_033077.1:g.2814C>G, NM_001122955.3:c.863+290C>G, NM_001130702.2:c.671+290C>G, NM_032667.6:c.671+290C>G, NR_037946.1:n.3383+290C>G, NR_037948.1:n.1465+290C>G, NR_037949.1:n.1465+290C>G, XM_005273909.1:c.863+290C>G
            6.

            rs796447121 [Homo sapiens]
              CCTCCAATTGTAGGCAAATTTGCAT[A/G]TGGGGGTGTGGGTGCAGCATATGCC
              Chromosome:
              11:62703306
              Gene:
              BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              HGVS:
              NC_000011.10:g.62703306G>A, NC_000011.9:g.62470778G>A, NG_008461.1:g.11269C>T, NM_001122955.3:c.405-757C>T, NM_001130702.2:c.213-757C>T, NM_032667.6:c.213-757C>T, NR_037946.1:n.2925-757C>T, NR_037948.1:n.1007-757C>T, NR_037949.1:n.1007-757C>T, XM_005273909.1:c.405-757C>T
              7.

              rs796430990 [Homo sapiens]
                AAAAACAATAACAAAACAAAAAAAA[-/A]CCCATCTCTACTAAAAATACAAAAA
                Chromosome:
                11:62704577
                Gene:
                BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                no info
                HGVS:
                NC_000011.10:g.62704577delA, NC_000011.9:g.62472049delA, NG_008461.1:g.9998delT, NM_001122955.3:c.404+724delT, NM_001130702.2:c.212+724delT, NM_032667.6:c.212+724delT, NR_037946.1:n.2924+724delT, NR_037948.1:n.1006+724delT, NR_037949.1:n.1006+724delT, XM_005273909.1:c.404+724delT
                8.

                rs796275042 [Homo sapiens]
                  AGCCTGGGCAACAGAGAGAGACTCT[C/G]TATCAAAAAAAAAAAAAAAAGGATC
                  Chromosome:
                  11:62697789
                  Gene:
                  BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  no info
                  HGVS:
                  NC_000011.10:g.62697789G>C, NC_000011.9:g.62465261G>C, NG_008461.1:g.16786C>G, NM_001122955.3:c.487-3078C>G, NM_001130702.2:c.295-3078C>G, NM_032667.6:c.295-3078C>G, NR_037946.1:n.3007-3078C>G, NR_037948.1:n.1089-3078C>G, NR_037949.1:n.1089-3078C>G, XM_005273909.1:c.487-3078C>G
                  9.

                  rs796209524 [Homo sapiens]
                    AAGACTCTGTCTCAAAAAAAAAAAA[-/A]GAACGTATCCTTTATGAGAGCCTCC
                    Chromosome:
                    11:62700965
                    Gene:
                    BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    HGVS:
                    NC_000011.10:g.62700965delA, NC_000011.9:g.62468437delA, NG_008461.1:g.13610delT, NM_001122955.3:c.486+1503delT, NM_001130702.2:c.294+1503delT, NM_032667.6:c.294+1503delT, NR_037946.1:n.3006+1503delT, NR_037948.1:n.1088+1503delT, NR_037949.1:n.1088+1503delT, XM_005273909.1:c.486+1503delT
                    10.

                    rs786205073 [Homo sapiens]
                      ACCTTCTTGTCCCTACTTCCTGCCT[C/G]AGATACCTGCTATACAACTTCCCGA
                      Chromosome:
                      11:62691424
                      Gene:
                      BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView) LRRN4CL (GeneView)
                      Functional Consequence:
                      intron variant,upstream variant 2KB
                      Allele Origin:
                      G(germline)/C(germline)
                      Clinical significance:
                      Pathogenic
                      Validated:
                      no info
                      HGVS:
                      NC_000011.10:g.62691424G>C, NC_000011.9:g.62458896G>C, NG_008461.1:g.23151C>G, NG_033077.1:g.3476C>G, NM_001122955.3:c.864-3C>G, NM_001130702.2:c.672-283C>G, NM_032667.6:c.672-3C>G, NM_203422.3:c.-2003C>G, NR_037946.1:n.3384-3C>G, NR_037948.1:n.1466-3C>G, NR_037949.1:n.1466-3C>G, XM_005273909.1:c.864-3C>G
                      11.

                      rs786205072 [Homo sapiens]
                        CGCGCACTTCACTGGGCTCAGGTGA[A/G]GGGCCAACTGGAGTGAACCTTGGGC
                        Chromosome:
                        11:62692371
                        Gene:
                        BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Allele Origin:
                        G(germline)/A(germline)
                        Clinical significance:
                        Pathogenic
                        Validated:
                        by cluster
                        HGVS:
                        NC_000011.10:g.62692371C>T, NC_000011.9:g.62459843C>T, NG_008461.1:g.22204G>A, NG_033077.1:g.2529G>A, NM_001122955.3:c.863+5G>A, NM_001130702.2:c.671+5G>A, NM_032667.6:c.671+5G>A, NR_037946.1:n.3383+5G>A, NR_037948.1:n.1465+5G>A, NR_037949.1:n.1465+5G>A, XM_005273909.1:c.863+5G>A
                        18.

                        rs781626368 [Homo sapiens]
                          TGCAGAAGAGCACCCCAAACTGCAG[C/T]AGCAGCCTGCGGGCACGGCCTGCCA
                          Chromosome:
                          11:62705429
                          Gene:
                          BSCL2 (GeneView) GNG3 (GeneView) HNRNPUL2-BSCL2 (GeneView)
                          Functional Consequence:
                          nc transcript variant,synonymous codon,upstream variant 2KB
                          Validated:
                          no info
                          HGVS:
                          NC_000011.10:g.62705429C>T, NC_000011.9:g.62472901C>T, NG_008461.1:g.9146G>A, NM_001122955.3:c.276G>A, NM_001130702.2:c.84G>A, NM_032667.6:c.84G>A, NP_001116427.1:p.Leu92, NP_001124174.2:p.Leu28, NP_116056.3:p.Leu28, NR_037946.1:n.2796G>A, NR_037948.1:n.878G>A, NR_037949.1:n.878G>A, XM_005273909.1:c.276G>A, XM_006718500.2:c.-2136C>T, XP_005273966.1:p.Leu92
                          19.

                          rs781527096 [Homo sapiens]
                            TTGATAGAAGGCCCCTCTCACCTGT[A/G]GTAGAAATGCACAGGGCTGAGGTGG
                            Chromosome:
                            11:62705305
                            Gene:
                            BSCL2 (GeneView) GNG3 (GeneView) HNRNPUL2-BSCL2 (GeneView)
                            Functional Consequence:
                            missense,nc transcript variant,upstream variant 2KB
                            Validated:
                            no info
                            HGVS:
                            NC_000011.10:g.62705305A>G, NC_000011.9:g.62472777A>G, NG_008461.1:g.9270T>C, NM_001122955.3:c.400T>C, NM_001130702.2:c.208T>C, NM_032667.6:c.208T>C, NP_001116427.1:p.Tyr134His, NP_001124174.2:p.Tyr70His, NP_116056.3:p.Tyr70His, NR_037946.1:n.2920T>C, NR_037948.1:n.1002T>C, NR_037949.1:n.1002T>C, XM_005273909.1:c.400T>C, XM_006718500.2:c.-2260A>G, XP_005273966.1:p.Tyr134His
                            20.

                            rs781480846 [Homo sapiens]
                              ATTCTGTCAGCCCATCAGCCTTCCT[C/T]GGGGTGCTTTAAAACATTCTGCTCA
                              Chromosome:
                              11:62691741
                              Gene:
                              BSCL2 (GeneView) HNRNPUL2-BSCL2 (GeneView) LRRN4CL (GeneView)
                              Functional Consequence:
                              intron variant,upstream variant 2KB
                              Validated:
                              no info
                              HGVS:
                              NC_000011.10:g.62691741C>T, NC_000011.9:g.62459213C>T, NG_008461.1:g.22834G>A, NG_033077.1:g.3159G>A, NM_001122955.3:c.864-320G>A, NM_001130702.2:c.672-600G>A, NM_032667.6:c.672-320G>A, NM_203422.3:c.-2320G>A, NR_037946.1:n.3384-320G>A, NR_037948.1:n.1466-320G>A, NR_037949.1:n.1466-320G>A, XM_005273909.1:c.864-320G>A

                              Display Settings:

                              Format
                              Items per page
                              Sort by

                              Send to:

                              Choose Destination

                              Supplemental Content

                              Find related data

                              Recent activity

                              Your browsing activity is empty.

                              Activity recording is turned off.

                              Turn recording back on

                              See more...
                              Support Center