Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 500

1.
2.

rs782802270 [Homo sapiens]
    TATGACCCAGCAATCCCACTCCTAG[A/T]TATTTACCTTAAAGTAATGGAAACT
    Chromosome:
    10:46947963
    Gene:
    PTPN20 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    HGVS:
    NC_000010.10:g.48791399A>T, NC_000010.11:g.46947963T>A, NM_001042357.4:c.340+1288T>A, NM_001042358.4:c.313+1288T>A, NM_001042359.3:c.313+1288T>A, NM_001042360.3:c.7+36121T>A, NM_001042361.4:c.313+1288T>A, NM_001042362.3:c.313+1288T>A, NM_001042363.4:c.97+1288T>A, NM_001042364.4:c.97+1288T>A, NM_001042365.3:c.97+1288T>A, NM_001320681.1:c.97+1288T>A, NM_001320682.1:c.150+1288T>A, NM_001320683.1:c.340+1288T>A, NM_001320684.1:c.340+1288T>A, NM_001320685.1:c.256+1288T>A, NM_001320686.1:c.97+1288T>A, NM_001320688.1:c.97+1288T>A, NM_001320689.1:c.150+1288T>A, NM_001320690.1:c.150+1288T>A, NM_001320691.1:c.-293+1288T>A, NM_015605.8:c.340+1288T>A, XM_005270314.1:c.340+1288T>A, XM_005270315.1:c.97+1288T>A, XM_005277652.1:c.97+1288T>A, XM_005277653.1:c.97+1288T>A, XM_011539605.2:c.340+1288T>A, XM_011539606.2:c.340+1288T>A, XM_011539607.2:c.340+1288T>A, XM_011539610.2:c.97+1288T>A, XM_017016042.1:c.340+1288T>A, XM_017016043.1:c.340+1288T>A, XM_017016044.1:c.256+1288T>A, XM_017016046.1:c.340+1288T>A, XM_017016047.1:c.340+1288T>A, XM_017016048.1:c.340+1288T>A, XM_017016049.1:c.97+1288T>A, XM_017016050.1:c.349+1288T>A, XM_017016051.1:c.340+1288T>A, XM_017016052.1:c.340+1288T>A, XM_017016053.1:c.340+1288T>A, XM_017016054.1:c.256+1288T>A, XM_017016055.1:c.340+1288T>A, XM_017016056.1:c.313+1288T>A, XM_017016057.1:c.-293+8T>A, XM_017016058.1:c.-292-17023T>A, XM_017016059.1:c.97+1288T>A, XM_017016060.1:c.340+1288T>A, XM_017016061.1:c.256+1288T>A, XM_017016062.1:c.256+1288T>A, XM_017016063.1:c.97+1288T>A, XM_017016064.1:c.97+1288T>A, XM_017016065.1:c.97+1288T>A, XR_001747082.1:n.548+1288T>A, XR_001747083.1:n.548+1288T>A, XR_001747084.1:n.548+1288T>A, XR_001747085.1:n.548+1288T>A
    3.

    rs782796916 [Homo sapiens]
      CTTTGTGTTTTGGTGCTTTTTTGTA[C/T]TTCCCAAATTCTTCACAATAAACCT
      Chromosome:
      10:46932820
      Gene:
      PTPN20 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000010.10:g.48806542C>T, NC_000010.11:g.46932820G>C, NC_000010.11:g.46932820G>T, NM_001042357.4:c.34+287G>A, NM_001042357.4:c.34+287G>C, NM_001042357.4:c.34+287G>T, NM_001042358.4:c.8-7803G>A, NM_001042358.4:c.8-7803G>C, NM_001042358.4:c.8-7803G>T, NM_001042359.3:c.8-7803G>A, NM_001042359.3:c.8-7803G>C, NM_001042359.3:c.8-7803G>T, NM_001042360.3:c.7+20978G>A, NM_001042360.3:c.7+20978G>C, NM_001042360.3:c.7+20978G>T, NM_001042361.4:c.8-7803G>A, NM_001042361.4:c.8-7803G>C, NM_001042361.4:c.8-7803G>T, NM_001042362.3:c.8-7803G>A, NM_001042362.3:c.8-7803G>C, NM_001042362.3:c.8-7803G>T, NM_001042363.4:c.-209-7803G>A, NM_001042363.4:c.-209-7803G>C, NM_001042363.4:c.-209-7803G>T, NM_001042364.4:c.-114-11098G>A, NM_001042364.4:c.-114-11098G>C, NM_001042364.4:c.-114-11098G>T, NM_001042365.3:c.-16-13743G>A, NM_001042365.3:c.-16-13743G>C, NM_001042365.3:c.-16-13743G>T, NM_001320681.1:c.-114-11098G>A, NM_001320681.1:c.-114-11098G>C, NM_001320681.1:c.-114-11098G>T, NM_001320682.1:c.-61-11098G>A, NM_001320682.1:c.-61-11098G>C, NM_001320682.1:c.-61-11098G>T, NM_001320683.1:c.34+287G>A, NM_001320683.1:c.34+287G>C, NM_001320683.1:c.34+287G>T, NM_001320684.1:c.34+287G>A, NM_001320684.1:c.34+287G>C, NM_001320684.1:c.34+287G>T, NM_001320685.1:c.45+287G>A, NM_001320685.1:c.45+287G>C, NM_001320685.1:c.45+287G>T, NM_001320686.1:c.-114-11098G>A, NM_001320686.1:c.-114-11098G>C, NM_001320686.1:c.-114-11098G>T, NM_001320688.1:c.-114-11098G>A, NM_001320688.1:c.-114-11098G>C, NM_001320688.1:c.-114-11098G>T, NM_001320689.1:c.-197-7762G>A, NM_001320689.1:c.-197-7762G>C, NM_001320689.1:c.-197-7762G>T, NM_001320690.1:c.-61-11098G>A, NM_001320690.1:c.-61-11098G>C, NM_001320690.1:c.-61-11098G>T, NM_001320691.1:c.-503-11098G>A, NM_001320691.1:c.-503-11098G>C, NM_001320691.1:c.-503-11098G>T, NM_015605.8:c.34+287G>A, NM_015605.8:c.34+287G>C, NM_015605.8:c.34+287G>T, XM_005270314.1:c.34+287G>A, XM_005270315.1:c.-114-11098G>A, XM_005277652.1:c.-250-7762G>A, XM_005277653.1:c.-114-11098G>A, XM_011539605.2:c.34+287G>C, XM_011539605.2:c.34+287G>T, XM_011539606.2:c.34+287G>C, XM_011539606.2:c.34+287G>T, XM_011539607.2:c.34+287G>C, XM_011539607.2:c.34+287G>T, XM_011539610.2:c.-16-13743G>C, XM_011539610.2:c.-16-13743G>T, XM_017016042.1:c.34+287G>C, XM_017016042.1:c.34+287G>T, XM_017016043.1:c.34+287G>C, XM_017016043.1:c.34+287G>T, XM_017016044.1:c.45+287G>C, XM_017016044.1:c.45+287G>T, XM_017016046.1:c.34+287G>C, XM_017016046.1:c.34+287G>T, XM_017016047.1:c.34+287G>C, XM_017016047.1:c.34+287G>T, XM_017016048.1:c.34+287G>C, XM_017016048.1:c.34+287G>T, XM_017016049.1:c.-114-11098G>C, XM_017016049.1:c.-114-11098G>T, XM_017016050.1:c.237-13743G>C, XM_017016050.1:c.237-13743G>T, XM_017016051.1:c.34+287G>C, XM_017016051.1:c.34+287G>T, XM_017016052.1:c.34+287G>C, XM_017016052.1:c.34+287G>T, XM_017016053.1:c.34+287G>C, XM_017016053.1:c.34+287G>T, XM_017016054.1:c.45+287G>C, XM_017016054.1:c.45+287G>T, XM_017016055.1:c.34+287G>C, XM_017016055.1:c.34+287G>T, XM_017016056.1:c.8-7803G>C, XM_017016056.1:c.8-7803G>T, XM_017016057.1:c.-520-13743G>C, XM_017016057.1:c.-520-13743G>T, XM_017016058.1:c.-293+21319G>C, XM_017016058.1:c.-293+21319G>T, XM_017016059.1:c.-114-11098G>C, XM_017016059.1:c.-114-11098G>T, XM_017016060.1:c.34+287G>C, XM_017016060.1:c.34+287G>T, XM_017016061.1:c.45+287G>C, XM_017016061.1:c.45+287G>T, XM_017016062.1:c.45+287G>C, XM_017016062.1:c.45+287G>T, XM_017016063.1:c.-251+287G>C, XM_017016063.1:c.-251+287G>T, XM_017016064.1:c.-114-11098G>C, XM_017016064.1:c.-114-11098G>T, XM_017016065.1:c.-209-7803G>C, XM_017016065.1:c.-209-7803G>T, XR_001747082.1:n.242+287G>C, XR_001747082.1:n.242+287G>T, XR_001747083.1:n.242+287G>C, XR_001747083.1:n.242+287G>T, XR_001747084.1:n.242+287G>C, XR_001747084.1:n.242+287G>T, XR_001747085.1:n.242+287G>C, XR_001747085.1:n.242+287G>T
      4.

      rs782765078 [Homo sapiens]
        CAATAAAAAAGAAATTAAATACTGA[C/T]AAATGCAATGACACAGATGAATATC
        Chromosome:
        10:46947810
        Gene:
        PTPN20 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by frequency
        HGVS:
        NC_000010.10:g.48791552T>C, NC_000010.11:g.46947810A>C, NC_000010.11:g.46947810A>T, NM_001042357.4:c.340+1135A>C, NM_001042357.4:c.340+1135A>G, NM_001042357.4:c.340+1135A>T, NM_001042358.4:c.313+1135A>C, NM_001042358.4:c.313+1135A>G, NM_001042358.4:c.313+1135A>T, NM_001042359.3:c.313+1135A>C, NM_001042359.3:c.313+1135A>G, NM_001042359.3:c.313+1135A>T, NM_001042360.3:c.7+35968A>C, NM_001042360.3:c.7+35968A>G, NM_001042360.3:c.7+35968A>T, NM_001042361.4:c.313+1135A>C, NM_001042361.4:c.313+1135A>G, NM_001042361.4:c.313+1135A>T, NM_001042362.3:c.313+1135A>C, NM_001042362.3:c.313+1135A>G, NM_001042362.3:c.313+1135A>T, NM_001042363.4:c.97+1135A>C, NM_001042363.4:c.97+1135A>G, NM_001042363.4:c.97+1135A>T, NM_001042364.4:c.97+1135A>C, NM_001042364.4:c.97+1135A>G, NM_001042364.4:c.97+1135A>T, NM_001042365.3:c.97+1135A>C, NM_001042365.3:c.97+1135A>G, NM_001042365.3:c.97+1135A>T, NM_001320681.1:c.97+1135A>C, NM_001320681.1:c.97+1135A>G, NM_001320681.1:c.97+1135A>T, NM_001320682.1:c.150+1135A>C, NM_001320682.1:c.150+1135A>G, NM_001320682.1:c.150+1135A>T, NM_001320683.1:c.340+1135A>C, NM_001320683.1:c.340+1135A>G, NM_001320683.1:c.340+1135A>T, NM_001320684.1:c.340+1135A>C, NM_001320684.1:c.340+1135A>G, NM_001320684.1:c.340+1135A>T, NM_001320685.1:c.256+1135A>C, NM_001320685.1:c.256+1135A>G, NM_001320685.1:c.256+1135A>T, NM_001320686.1:c.97+1135A>C, NM_001320686.1:c.97+1135A>G, NM_001320686.1:c.97+1135A>T, NM_001320688.1:c.97+1135A>C, NM_001320688.1:c.97+1135A>G, NM_001320688.1:c.97+1135A>T, NM_001320689.1:c.150+1135A>C, NM_001320689.1:c.150+1135A>G, NM_001320689.1:c.150+1135A>T, NM_001320690.1:c.150+1135A>C, NM_001320690.1:c.150+1135A>G, NM_001320690.1:c.150+1135A>T, NM_001320691.1:c.-293+1135A>C, NM_001320691.1:c.-293+1135A>G, NM_001320691.1:c.-293+1135A>T, NM_015605.8:c.340+1135A>C, NM_015605.8:c.340+1135A>G, NM_015605.8:c.340+1135A>T, XM_005270314.1:c.340+1135A>G, XM_005270315.1:c.97+1135A>G, XM_005277652.1:c.97+1135A>G, XM_005277653.1:c.97+1135A>G, XM_011539605.2:c.340+1135A>C, XM_011539605.2:c.340+1135A>T, XM_011539606.2:c.340+1135A>C, XM_011539606.2:c.340+1135A>T, XM_011539607.2:c.340+1135A>C, XM_011539607.2:c.340+1135A>T, XM_011539610.2:c.97+1135A>C, XM_011539610.2:c.97+1135A>T, XM_017016042.1:c.340+1135A>C, XM_017016042.1:c.340+1135A>T, XM_017016043.1:c.340+1135A>C, XM_017016043.1:c.340+1135A>T, XM_017016044.1:c.256+1135A>C, XM_017016044.1:c.256+1135A>T, XM_017016046.1:c.340+1135A>C, XM_017016046.1:c.340+1135A>T, XM_017016047.1:c.340+1135A>C, XM_017016047.1:c.340+1135A>T, XM_017016048.1:c.340+1135A>C, XM_017016048.1:c.340+1135A>T, XM_017016049.1:c.97+1135A>C, XM_017016049.1:c.97+1135A>T, XM_017016050.1:c.349+1135A>C, XM_017016050.1:c.349+1135A>T, XM_017016051.1:c.340+1135A>C, XM_017016051.1:c.340+1135A>T, XM_017016052.1:c.340+1135A>C, XM_017016052.1:c.340+1135A>T, XM_017016053.1:c.340+1135A>C, XM_017016053.1:c.340+1135A>T, XM_017016054.1:c.256+1135A>C, XM_017016054.1:c.256+1135A>T, XM_017016055.1:c.340+1135A>C, XM_017016055.1:c.340+1135A>T, XM_017016056.1:c.313+1135A>C, XM_017016056.1:c.313+1135A>T, XM_017016057.1:c.-407-31A>C, XM_017016057.1:c.-407-31A>T, XM_017016058.1:c.-292-17176A>C, XM_017016058.1:c.-292-17176A>T, XM_017016059.1:c.97+1135A>C, XM_017016059.1:c.97+1135A>T, XM_017016060.1:c.340+1135A>C, XM_017016060.1:c.340+1135A>T, XM_017016061.1:c.256+1135A>C, XM_017016061.1:c.256+1135A>T, XM_017016062.1:c.256+1135A>C, XM_017016062.1:c.256+1135A>T, XM_017016063.1:c.97+1135A>C, XM_017016063.1:c.97+1135A>T, XM_017016064.1:c.97+1135A>C, XM_017016064.1:c.97+1135A>T, XM_017016065.1:c.97+1135A>C, XM_017016065.1:c.97+1135A>T, XR_001747082.1:n.548+1135A>C, XR_001747082.1:n.548+1135A>T, XR_001747083.1:n.548+1135A>C, XR_001747083.1:n.548+1135A>T, XR_001747084.1:n.548+1135A>C, XR_001747084.1:n.548+1135A>T, XR_001747085.1:n.548+1135A>C, XR_001747085.1:n.548+1135A>T
        5.

        rs782754933 [Homo sapiens]
          TTTGAACCATGCCAGAACGTTGTTC[C/T]CTCATTTGGGCCACTATATCCATGA
          Chromosome:
          10:46999944
          Gene:
          PTPN20 (GeneView)
          Functional Consequence:
          missense,nc transcript variant,stop gained,synonymous codon
          Validated:
          no info
          HGVS:
          NC_000010.10:g.48739418T>C, NC_000010.11:g.46999944A>C, NC_000010.11:g.46999944A>T, NM_001042357.4:c.1167A>C, NM_001042357.4:c.1167A>G, NM_001042357.4:c.1167A>T, NM_001042358.4:c.1140A>C, NM_001042358.4:c.1140A>G, NM_001042358.4:c.1140A>T, NM_001042359.3:c.714A>C, NM_001042359.3:c.714A>G, NM_001042359.3:c.714A>T, NM_001042360.3:c.591A>C, NM_001042360.3:c.591A>G, NM_001042360.3:c.591A>T, NM_001042361.4:c.589A>C, NM_001042361.4:c.589A>G, NM_001042361.4:c.589A>T, NM_001042362.3:c.346A>C, NM_001042362.3:c.346A>G, NM_001042362.3:c.346A>T, NM_001042363.4:c.924A>C, NM_001042363.4:c.924A>G, NM_001042363.4:c.924A>T, NM_001042364.4:c.373A>C, NM_001042364.4:c.373A>G, NM_001042364.4:c.373A>T, NM_001042365.3:c.130A>C, NM_001042365.3:c.130A>G, NM_001042365.3:c.130A>T, NM_001320681.1:c.924A>C, NM_001320681.1:c.924A>G, NM_001320681.1:c.924A>T, NM_001320682.1:c.183A>C, NM_001320682.1:c.183A>G, NM_001320682.1:c.183A>T, NM_001320683.1:c.616A>C, NM_001320683.1:c.616A>G, NM_001320683.1:c.616A>T, NM_001320684.1:c.525A>C, NM_001320684.1:c.525A>G, NM_001320684.1:c.525A>T, NM_001320685.1:c.1083A>C, NM_001320685.1:c.1083A>G, NM_001320685.1:c.1083A>T, NM_001320686.1:c.924A>C, NM_001320686.1:c.924A>G, NM_001320686.1:c.924A>T, NM_001320688.1:c.498A>C, NM_001320688.1:c.498A>G, NM_001320688.1:c.498A>T, NM_001320689.1:c.183A>C, NM_001320689.1:c.183A>G, NM_001320689.1:c.183A>T, NM_001320690.1:c.183A>C, NM_001320690.1:c.183A>G, NM_001320690.1:c.183A>T, NM_001320691.1:c.444A>C, NM_001320691.1:c.444A>G, NM_001320691.1:c.444A>T, NM_015605.8:c.616A>C, NM_015605.8:c.616A>G, NM_015605.8:c.616A>T, NP_001035816.1:p.Arg389, NP_001035816.1:p.Arg389Ser, NP_001035817.1:p.Arg380, NP_001035817.1:p.Arg380Ser, NP_001035818.1:p.Arg238, NP_001035818.1:p.Arg238Ser, NP_001035819.1:p.Arg197, NP_001035819.1:p.Arg197Ser, NP_001035820.1:p.Arg197, NP_001035820.1:p.Arg197Gly, NP_001035820.1:p.Arg197Ter, NP_001035821.1:p.Arg116, NP_001035821.1:p.Arg116Gly, NP_001035821.1:p.Arg116Ter, NP_001035822.1:p.Arg308, NP_001035822.1:p.Arg308Ser, NP_001035823.1:p.Arg125, NP_001035823.1:p.Arg125Gly, NP_001035823.1:p.Arg125Ter, NP_001035824.1:p.Arg44, NP_001035824.1:p.Arg44Gly, NP_001035824.1:p.Arg44Ter, NP_001307610.1:p.Arg308, NP_001307610.1:p.Arg308Ser, NP_001307611.1:p.Arg61, NP_001307611.1:p.Arg61Ser, NP_001307612.1:p.Arg206, NP_001307612.1:p.Arg206Gly, NP_001307612.1:p.Arg206Ter, NP_001307613.1:p.Arg175, NP_001307613.1:p.Arg175Ser, NP_001307614.1:p.Arg361, NP_001307614.1:p.Arg361Ser, NP_001307615.1:p.Arg308, NP_001307615.1:p.Arg308Ser, NP_001307617.1:p.Arg166, NP_001307617.1:p.Arg166Ser, NP_001307618.1:p.Arg61, NP_001307618.1:p.Arg61Ser, NP_001307619.1:p.Arg61, NP_001307619.1:p.Arg61Ser, NP_001307620.1:p.Arg148, NP_001307620.1:p.Arg148Ser, NP_056420.3:p.Arg206, NP_056420.3:p.Arg206Gly, NP_056420.3:p.Arg206Ter, XM_005270314.1:c.1167A>G, XM_005270315.1:c.924A>G, XM_005277652.1:c.924A>G, XM_005277653.1:c.924A>G, XM_011539605.2:c.1167A>C, XM_011539605.2:c.1167A>T, XM_011539606.2:c.1167A>C, XM_011539606.2:c.1167A>T, XM_011539607.2:c.1167A>C, XM_011539607.2:c.1167A>T, XM_011539610.2:c.924A>C, XM_011539610.2:c.924A>T, XM_011539611.2:c.903A>C, XM_011539611.2:c.903A>T, XM_017016042.1:c.1167A>C, XM_017016042.1:c.1167A>T, XM_017016043.1:c.1167A>C, XM_017016043.1:c.1167A>T, XM_017016044.1:c.1083A>C, XM_017016044.1:c.1083A>T, XM_017016045.1:c.1047A>C, XM_017016045.1:c.1047A>T, XM_017016046.1:c.951A>C, XM_017016046.1:c.951A>T, XM_017016047.1:c.951A>C, XM_017016047.1:c.951A>T, XM_017016048.1:c.951A>C, XM_017016048.1:c.951A>T, XM_017016049.1:c.708A>C, XM_017016049.1:c.708A>T, XM_017016050.1:c.625A>C, XM_017016050.1:c.625A>T, XM_017016051.1:c.616A>C, XM_017016051.1:c.616A>T, XM_017016052.1:c.616A>C, XM_017016052.1:c.616A>T, XM_017016053.1:c.525A>C, XM_017016053.1:c.525A>T, XM_017016054.1:c.532A>C, XM_017016054.1:c.532A>T, XM_017016055.1:c.525A>C, XM_017016055.1:c.525A>T, XM_017016056.1:c.498A>C, XM_017016056.1:c.498A>T, XM_017016057.1:c.444A>C, XM_017016057.1:c.444A>T, XM_017016058.1:c.444A>C, XM_017016058.1:c.444A>T, XM_017016059.1:c.373A>C, XM_017016059.1:c.373A>T, XM_017016060.1:c.373A>C, XM_017016060.1:c.373A>T, XM_017016061.1:c.289A>C, XM_017016061.1:c.289A>T, XM_017016062.1:c.289A>C, XM_017016062.1:c.289A>T, XM_017016063.1:c.130A>C, XM_017016063.1:c.130A>T, XM_017016064.1:c.130A>C, XM_017016064.1:c.130A>T, XM_017016065.1:c.130A>C, XM_017016065.1:c.130A>T, XP_005270371.1:p.Arg389, XP_005270372.1:p.Arg308, XP_005277709.1:p.Arg308, XP_005277710.1:p.Arg308, XP_011537907.1:p.Arg389Ser, XP_011537908.1:p.Arg389Ser, XP_011537909.1:p.Arg389Ser, XP_011537912.1:p.Arg308Ser, XP_011537913.1:p.Arg301Ser, XP_016871531.1:p.Arg389Ser, XP_016871532.1:p.Arg389Ser, XP_016871533.1:p.Arg361Ser, XP_016871534.1:p.Arg349Ser, XP_016871535.1:p.Arg317Ser, XP_016871536.1:p.Arg317Ser, XP_016871537.1:p.Arg317Ser, XP_016871538.1:p.Arg236Ser, XP_016871539.1:p.Arg209, XP_016871539.1:p.Arg209Ter, XP_016871540.1:p.Arg206, XP_016871540.1:p.Arg206Ter, XP_016871541.1:p.Arg206, XP_016871541.1:p.Arg206Ter, XP_016871542.1:p.Arg175Ser, XP_016871543.1:p.Arg178, XP_016871543.1:p.Arg178Ter, XP_016871544.1:p.Arg175Ser, XP_016871545.1:p.Arg166Ser, XP_016871546.1:p.Arg148Ser, XP_016871547.1:p.Arg148Ser, XP_016871548.1:p.Arg125, XP_016871548.1:p.Arg125Ter, XP_016871549.1:p.Arg125, XP_016871549.1:p.Arg125Ter, XP_016871550.1:p.Arg97, XP_016871550.1:p.Arg97Ter, XP_016871551.1:p.Arg97, XP_016871551.1:p.Arg97Ter, XP_016871552.1:p.Arg44, XP_016871552.1:p.Arg44Ter, XP_016871553.1:p.Arg44, XP_016871553.1:p.Arg44Ter, XP_016871554.1:p.Arg44, XP_016871554.1:p.Arg44Ter, XR_001747082.1:n.1692A>C, XR_001747082.1:n.1692A>T, XR_001747083.1:n.1040A>C, XR_001747083.1:n.1040A>T, XR_001747084.1:n.1284A>C, XR_001747084.1:n.1284A>T, XR_001747085.1:n.1068A>C, XR_001747085.1:n.1068A>T
          6.

          rs782736123 [Homo sapiens]
            TTCACATATGTAAGTTACTGGTATA[C/T]ATGTGAAGGGAGATTTTATTTTTGT
            Chromosome:
            10:46964944
            Gene:
            PTPN20 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB
            Validated:
            by cluster
            HGVS:
            NC_000010.10:g.48774418T>C, NC_000010.11:g.46964944A>C, NC_000010.11:g.46964944A>T, NM_001042357.4:c.341-42A>C, NM_001042357.4:c.341-42A>G, NM_001042357.4:c.341-42A>T, NM_001042358.4:c.314-42A>C, NM_001042358.4:c.314-42A>G, NM_001042358.4:c.314-42A>T, NM_001042359.3:c.314-42A>C, NM_001042359.3:c.314-42A>G, NM_001042359.3:c.314-42A>T, NM_001042360.3:c.8-19286A>C, NM_001042360.3:c.8-19286A>G, NM_001042360.3:c.8-19286A>T, NM_001042361.4:c.314-42A>C, NM_001042361.4:c.314-42A>G, NM_001042361.4:c.314-42A>T, NM_001042362.3:c.313+18269A>C, NM_001042362.3:c.313+18269A>G, NM_001042362.3:c.313+18269A>T, NM_001042363.4:c.98-42A>C, NM_001042363.4:c.98-42A>G, NM_001042363.4:c.98-42A>T, NM_001042364.4:c.98-42A>C, NM_001042364.4:c.98-42A>G, NM_001042364.4:c.98-42A>T, NM_001042365.3:c.97+18269A>C, NM_001042365.3:c.97+18269A>G, NM_001042365.3:c.97+18269A>T, NM_001320681.1:c.98-42A>C, NM_001320681.1:c.98-42A>G, NM_001320681.1:c.98-42A>T, NM_001320682.1:c.150+18269A>C, NM_001320682.1:c.150+18269A>G, NM_001320682.1:c.150+18269A>T, NM_001320683.1:c.341-42A>C, NM_001320683.1:c.341-42A>G, NM_001320683.1:c.341-42A>T, NM_001320684.1:c.341-42A>C, NM_001320684.1:c.341-42A>G, NM_001320684.1:c.341-42A>T, NM_001320685.1:c.257-42A>C, NM_001320685.1:c.257-42A>G, NM_001320685.1:c.257-42A>T, NM_001320686.1:c.98-42A>C, NM_001320686.1:c.98-42A>G, NM_001320686.1:c.98-42A>T, NM_001320688.1:c.98-42A>C, NM_001320688.1:c.98-42A>G, NM_001320688.1:c.98-42A>T, NM_001320689.1:c.150+18269A>C, NM_001320689.1:c.150+18269A>G, NM_001320689.1:c.150+18269A>T, NM_001320690.1:c.150+18269A>C, NM_001320690.1:c.150+18269A>G, NM_001320690.1:c.150+18269A>T, NM_001320691.1:c.-292-42A>C, NM_001320691.1:c.-292-42A>G, NM_001320691.1:c.-292-42A>T, NM_015605.8:c.341-42A>C, NM_015605.8:c.341-42A>G, NM_015605.8:c.341-42A>T, XM_005270314.1:c.341-42A>G, XM_005270315.1:c.98-42A>G, XM_005277652.1:c.98-42A>G, XM_005277653.1:c.98-42A>G, XM_011539605.2:c.341-42A>C, XM_011539605.2:c.341-42A>T, XM_011539606.2:c.341-42A>C, XM_011539606.2:c.341-42A>T, XM_011539607.2:c.341-42A>C, XM_011539607.2:c.341-42A>T, XM_011539610.2:c.98-42A>C, XM_011539610.2:c.98-42A>T, XM_011539611.2:c.-283A>C, XM_011539611.2:c.-283A>T, XM_017016042.1:c.341-42A>C, XM_017016042.1:c.341-42A>T, XM_017016043.1:c.341-42A>C, XM_017016043.1:c.341-42A>T, XM_017016044.1:c.257-42A>C, XM_017016044.1:c.257-42A>T, XM_017016046.1:c.341-42A>C, XM_017016046.1:c.341-42A>T, XM_017016047.1:c.341-42A>C, XM_017016047.1:c.341-42A>T, XM_017016048.1:c.341-42A>C, XM_017016048.1:c.341-42A>T, XM_017016049.1:c.98-42A>C, XM_017016049.1:c.98-42A>T, XM_017016050.1:c.350-42A>C, XM_017016050.1:c.350-42A>T, XM_017016051.1:c.341-42A>C, XM_017016051.1:c.341-42A>T, XM_017016052.1:c.341-42A>C, XM_017016052.1:c.341-42A>T, XM_017016053.1:c.341-42A>C, XM_017016053.1:c.341-42A>T, XM_017016054.1:c.257-42A>C, XM_017016054.1:c.257-42A>T, XM_017016055.1:c.341-42A>C, XM_017016055.1:c.341-42A>T, XM_017016056.1:c.314-42A>C, XM_017016056.1:c.314-42A>T, XM_017016057.1:c.-292-42A>C, XM_017016057.1:c.-292-42A>T, XM_017016058.1:c.-292-42A>C, XM_017016058.1:c.-292-42A>T, XM_017016059.1:c.98-42A>C, XM_017016059.1:c.98-42A>T, XM_017016060.1:c.340+18269A>C, XM_017016060.1:c.340+18269A>T, XM_017016061.1:c.256+18269A>C, XM_017016061.1:c.256+18269A>T, XM_017016062.1:c.256+18269A>C, XM_017016062.1:c.256+18269A>T, XM_017016063.1:c.97+18269A>C, XM_017016063.1:c.97+18269A>T, XM_017016064.1:c.97+18269A>C, XM_017016064.1:c.97+18269A>T, XM_017016065.1:c.97+18269A>C, XM_017016065.1:c.97+18269A>T, XR_001747082.1:n.549-42A>C, XR_001747082.1:n.549-42A>T, XR_001747083.1:n.549-42A>C, XR_001747083.1:n.549-42A>T, XR_001747084.1:n.549-42A>C, XR_001747084.1:n.549-42A>T, XR_001747085.1:n.549-42A>C, XR_001747085.1:n.549-42A>T
            7.

            rs782689648 [Homo sapiens]
              TATTCATTATTCTTATTATTATGTA[A/C/G/T]GTGGTGAAAGCTTACCTTCGTTTGA
              Validated:
              by frequency
              HGVS:
              NC_000010.10:g.48739372T>A, NC_000010.10:g.48739372T>C, NC_000010.10:g.48739372T>G, NM_001042357.4:c.1197+16A>C, NM_001042357.4:c.1197+16A>G, NM_001042357.4:c.1197+16A>T, NM_001042358.4:c.1170+16A>C, NM_001042358.4:c.1170+16A>G, NM_001042358.4:c.1170+16A>T, NM_001042359.3:c.744+16A>C, NM_001042359.3:c.744+16A>G, NM_001042359.3:c.744+16A>T, NM_001042360.3:c.621+16A>C, NM_001042360.3:c.621+16A>G, NM_001042360.3:c.621+16A>T, NM_001042361.4:c.619+16A>C, NM_001042361.4:c.619+16A>G, NM_001042361.4:c.619+16A>T, NM_001042362.3:c.376+16A>C, NM_001042362.3:c.376+16A>G, NM_001042362.3:c.376+16A>T, NM_001042363.4:c.954+16A>C, NM_001042363.4:c.954+16A>G, NM_001042363.4:c.954+16A>T, NM_001042364.4:c.403+16A>C, NM_001042364.4:c.403+16A>G, NM_001042364.4:c.403+16A>T, NM_001042365.3:c.160+16A>C, NM_001042365.3:c.160+16A>G, NM_001042365.3:c.160+16A>T, NM_001320681.1:c.954+16A>C, NM_001320681.1:c.954+16A>G, NM_001320681.1:c.954+16A>T, NM_001320682.1:c.213+16A>C, NM_001320682.1:c.213+16A>G, NM_001320682.1:c.213+16A>T, NM_001320683.1:c.646+16A>C, NM_001320683.1:c.646+16A>G, NM_001320683.1:c.646+16A>T, NM_001320684.1:c.555+16A>C, NM_001320684.1:c.555+16A>G, NM_001320684.1:c.555+16A>T, NM_001320685.1:c.1113+16A>C, NM_001320685.1:c.1113+16A>G, NM_001320685.1:c.1113+16A>T, NM_001320686.1:c.954+16A>C, NM_001320686.1:c.954+16A>G, NM_001320686.1:c.954+16A>T, NM_001320688.1:c.528+16A>C, NM_001320688.1:c.528+16A>G, NM_001320688.1:c.528+16A>T, NM_001320689.1:c.213+16A>C, NM_001320689.1:c.213+16A>G, NM_001320689.1:c.213+16A>T, NM_001320690.1:c.213+16A>C, NM_001320690.1:c.213+16A>G, NM_001320690.1:c.213+16A>T, NM_001320691.1:c.474+16A>C, NM_001320691.1:c.474+16A>G, NM_001320691.1:c.474+16A>T, NM_015605.8:c.646+16A>C, NM_015605.8:c.646+16A>G, NM_015605.8:c.646+16A>T, XM_005270314.1:c.1197+16A>C, XM_005270314.1:c.1197+16A>G, XM_005270314.1:c.1197+16A>T, XM_005270315.1:c.954+16A>C, XM_005270315.1:c.954+16A>G, XM_005270315.1:c.954+16A>T, XM_005277652.1:c.954+16A>C, XM_005277652.1:c.954+16A>G, XM_005277652.1:c.954+16A>T, XM_005277653.1:c.954+16A>C, XM_005277653.1:c.954+16A>G, XM_005277653.1:c.954+16A>T
              8.

              rs782678312 [Homo sapiens]
                CTGCATATAGTTACTCTCTAGCTTG[-/T]TTTTTTTTTTTTTATCCTCTTCATT
                Chromosome:
                10:46997630
                Gene:
                PTPN20 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                no info
                HGVS:
                NC_000010.10:g.48741731_48741732insT, NC_000010.11:g.46997630_46997631insT, NM_001042357.4:c.1135-2282_1135-2281insA, NM_001042357.4:c.1135-2282_1135-2281insT, NM_001042358.4:c.1108-2282_1108-2281insA, NM_001042358.4:c.1108-2282_1108-2281insT, NM_001042359.3:c.682-2282_682-2281insA, NM_001042359.3:c.682-2282_682-2281insT, NM_001042360.3:c.559-2282_559-2281insA, NM_001042360.3:c.559-2282_559-2281insT, NM_001042361.4:c.557-2282_557-2281insA, NM_001042361.4:c.557-2282_557-2281insT, NM_001042362.3:c.314-2282_314-2281insA, NM_001042362.3:c.314-2282_314-2281insT, NM_001042363.4:c.892-2282_892-2281insA, NM_001042363.4:c.892-2282_892-2281insT, NM_001042364.4:c.341-2282_341-2281insA, NM_001042364.4:c.341-2282_341-2281insT, NM_001042365.3:c.98-2282_98-2281insA, NM_001042365.3:c.98-2282_98-2281insT, NM_001320681.1:c.892-2282_892-2281insA, NM_001320681.1:c.892-2282_892-2281insT, NM_001320682.1:c.151-2282_151-2281insA, NM_001320682.1:c.151-2282_151-2281insT, NM_001320683.1:c.584-2282_584-2281insA, NM_001320683.1:c.584-2282_584-2281insT, NM_001320684.1:c.493-2282_493-2281insA, NM_001320684.1:c.493-2282_493-2281insT, NM_001320685.1:c.1051-2282_1051-2281insA, NM_001320685.1:c.1051-2282_1051-2281insT, NM_001320686.1:c.892-2282_892-2281insA, NM_001320686.1:c.892-2282_892-2281insT, NM_001320688.1:c.466-2282_466-2281insA, NM_001320688.1:c.466-2282_466-2281insT, NM_001320689.1:c.151-2282_151-2281insA, NM_001320689.1:c.151-2282_151-2281insT, NM_001320690.1:c.151-2282_151-2281insA, NM_001320690.1:c.151-2282_151-2281insT, NM_001320691.1:c.412-2282_412-2281insA, NM_001320691.1:c.412-2282_412-2281insT, NM_015605.8:c.584-2282_584-2281insA, NM_015605.8:c.584-2282_584-2281insT, XM_005270314.1:c.1135-2282_1135-2281insA, XM_005270315.1:c.892-2282_892-2281insA, XM_005277652.1:c.892-2282_892-2281insA, XM_005277653.1:c.892-2282_892-2281insA, XM_011539605.2:c.1135-2282_1135-2281insT, XM_011539606.2:c.1135-2282_1135-2281insT, XM_011539607.2:c.1135-2282_1135-2281insT, XM_011539610.2:c.892-2282_892-2281insT, XM_011539611.2:c.871-2282_871-2281insT, XM_017016042.1:c.1135-2282_1135-2281insT, XM_017016043.1:c.1135-2282_1135-2281insT, XM_017016044.1:c.1051-2282_1051-2281insT, XM_017016045.1:c.1015-2282_1015-2281insT, XM_017016046.1:c.919-2282_919-2281insT, XM_017016047.1:c.919-2282_919-2281insT, XM_017016048.1:c.919-2282_919-2281insT, XM_017016049.1:c.676-2282_676-2281insT, XM_017016050.1:c.593-2282_593-2281insT, XM_017016051.1:c.584-2282_584-2281insT, XM_017016052.1:c.584-2282_584-2281insT, XM_017016053.1:c.493-2282_493-2281insT, XM_017016054.1:c.500-2282_500-2281insT, XM_017016055.1:c.493-2282_493-2281insT, XM_017016056.1:c.466-2282_466-2281insT, XM_017016057.1:c.412-2282_412-2281insT, XM_017016058.1:c.412-2282_412-2281insT, XM_017016059.1:c.341-2282_341-2281insT, XM_017016060.1:c.341-2282_341-2281insT, XM_017016061.1:c.257-2282_257-2281insT, XM_017016062.1:c.257-2282_257-2281insT, XM_017016063.1:c.98-2282_98-2281insT, XM_017016064.1:c.98-2282_98-2281insT, XM_017016065.1:c.98-2282_98-2281insT, XR_001747082.1:n.1660-2282_1660-2281insT, XR_001747083.1:n.1008-2282_1008-2281insT, XR_001747084.1:n.1252-2282_1252-2281insT, XR_001747085.1:n.1036-2282_1036-2281insT
                9.

                rs782637997 [Homo sapiens]
                  GTGGTAAAGTGTTATGCAATGTTAA[C/G/T]CTTTATATTCATTATTCTTATTATT
                  Chromosome:
                  10:47000021
                  Gene:
                  PTPN20 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  by frequency
                  HGVS:
                  NC_000010.10:g.48739341T>C, NC_000010.10:g.48739341T>G, NC_000010.11:g.47000021A>C, NC_000010.11:g.47000021A>G, NC_000010.11:g.47000021A>T, NM_001042357.4:c.1197+47A>C, NM_001042357.4:c.1197+47A>G, NM_001042357.4:c.1197+47A>T, NM_001042358.4:c.1170+47A>C, NM_001042358.4:c.1170+47A>G, NM_001042358.4:c.1170+47A>T, NM_001042359.3:c.744+47A>C, NM_001042359.3:c.744+47A>G, NM_001042359.3:c.744+47A>T, NM_001042360.3:c.621+47A>C, NM_001042360.3:c.621+47A>G, NM_001042360.3:c.621+47A>T, NM_001042361.4:c.619+47A>C, NM_001042361.4:c.619+47A>G, NM_001042361.4:c.619+47A>T, NM_001042362.3:c.376+47A>C, NM_001042362.3:c.376+47A>G, NM_001042362.3:c.376+47A>T, NM_001042363.4:c.954+47A>C, NM_001042363.4:c.954+47A>G, NM_001042363.4:c.954+47A>T, NM_001042364.4:c.403+47A>C, NM_001042364.4:c.403+47A>G, NM_001042364.4:c.403+47A>T, NM_001042365.3:c.160+47A>C, NM_001042365.3:c.160+47A>G, NM_001042365.3:c.160+47A>T, NM_001320681.1:c.954+47A>C, NM_001320681.1:c.954+47A>G, NM_001320681.1:c.954+47A>T, NM_001320682.1:c.213+47A>C, NM_001320682.1:c.213+47A>G, NM_001320682.1:c.213+47A>T, NM_001320683.1:c.646+47A>C, NM_001320683.1:c.646+47A>G, NM_001320683.1:c.646+47A>T, NM_001320684.1:c.555+47A>C, NM_001320684.1:c.555+47A>G, NM_001320684.1:c.555+47A>T, NM_001320685.1:c.1113+47A>C, NM_001320685.1:c.1113+47A>G, NM_001320685.1:c.1113+47A>T, NM_001320686.1:c.954+47A>C, NM_001320686.1:c.954+47A>G, NM_001320686.1:c.954+47A>T, NM_001320688.1:c.528+47A>C, NM_001320688.1:c.528+47A>G, NM_001320688.1:c.528+47A>T, NM_001320689.1:c.213+47A>C, NM_001320689.1:c.213+47A>G, NM_001320689.1:c.213+47A>T, NM_001320690.1:c.213+47A>C, NM_001320690.1:c.213+47A>G, NM_001320690.1:c.213+47A>T, NM_001320691.1:c.474+47A>C, NM_001320691.1:c.474+47A>G, NM_001320691.1:c.474+47A>T, NM_015605.8:c.646+47A>C, NM_015605.8:c.646+47A>G, NM_015605.8:c.646+47A>T, XM_005270314.1:c.1197+47A>C, XM_005270314.1:c.1197+47A>G, XM_005270315.1:c.954+47A>C, XM_005270315.1:c.954+47A>G, XM_005277652.1:c.954+47A>C, XM_005277652.1:c.954+47A>G, XM_005277653.1:c.954+47A>C, XM_005277653.1:c.954+47A>G, XM_011539605.2:c.1197+47A>C, XM_011539605.2:c.1197+47A>G, XM_011539605.2:c.1197+47A>T, XM_011539606.2:c.1197+47A>C, XM_011539606.2:c.1197+47A>G, XM_011539606.2:c.1197+47A>T, XM_011539607.2:c.1197+47A>C, XM_011539607.2:c.1197+47A>G, XM_011539607.2:c.1197+47A>T, XM_011539610.2:c.954+47A>C, XM_011539610.2:c.954+47A>G, XM_011539610.2:c.954+47A>T, XM_011539611.2:c.933+47A>C, XM_011539611.2:c.933+47A>G, XM_011539611.2:c.933+47A>T, XM_017016042.1:c.1197+47A>C, XM_017016042.1:c.1197+47A>G, XM_017016042.1:c.1197+47A>T, XM_017016043.1:c.1197+47A>C, XM_017016043.1:c.1197+47A>G, XM_017016043.1:c.1197+47A>T, XM_017016044.1:c.1113+47A>C, XM_017016044.1:c.1113+47A>G, XM_017016044.1:c.1113+47A>T, XM_017016045.1:c.1077+47A>C, XM_017016045.1:c.1077+47A>G, XM_017016045.1:c.1077+47A>T, XM_017016046.1:c.981+47A>C, XM_017016046.1:c.981+47A>G, XM_017016046.1:c.981+47A>T, XM_017016047.1:c.981+47A>C, XM_017016047.1:c.981+47A>G, XM_017016047.1:c.981+47A>T, XM_017016048.1:c.981+47A>C, XM_017016048.1:c.981+47A>G, XM_017016048.1:c.981+47A>T, XM_017016049.1:c.738+47A>C, XM_017016049.1:c.738+47A>G, XM_017016049.1:c.738+47A>T, XM_017016050.1:c.655+47A>C, XM_017016050.1:c.655+47A>G, XM_017016050.1:c.655+47A>T, XM_017016051.1:c.646+47A>C, XM_017016051.1:c.646+47A>G, XM_017016051.1:c.646+47A>T, XM_017016052.1:c.646+47A>C, XM_017016052.1:c.646+47A>G, XM_017016052.1:c.646+47A>T, XM_017016053.1:c.555+47A>C, XM_017016053.1:c.555+47A>G, XM_017016053.1:c.555+47A>T, XM_017016054.1:c.562+47A>C, XM_017016054.1:c.562+47A>G, XM_017016054.1:c.562+47A>T, XM_017016055.1:c.555+47A>C, XM_017016055.1:c.555+47A>G, XM_017016055.1:c.555+47A>T, XM_017016056.1:c.528+47A>C, XM_017016056.1:c.528+47A>G, XM_017016056.1:c.528+47A>T, XM_017016057.1:c.474+47A>C, XM_017016057.1:c.474+47A>G, XM_017016057.1:c.474+47A>T, XM_017016058.1:c.474+47A>C, XM_017016058.1:c.474+47A>G, XM_017016058.1:c.474+47A>T, XM_017016059.1:c.403+47A>C, XM_017016059.1:c.403+47A>G, XM_017016059.1:c.403+47A>T, XM_017016060.1:c.403+47A>C, XM_017016060.1:c.403+47A>G, XM_017016060.1:c.403+47A>T, XM_017016061.1:c.319+47A>C, XM_017016061.1:c.319+47A>G, XM_017016061.1:c.319+47A>T, XM_017016062.1:c.319+47A>C, XM_017016062.1:c.319+47A>G, XM_017016062.1:c.319+47A>T, XM_017016063.1:c.160+47A>C, XM_017016063.1:c.160+47A>G, XM_017016063.1:c.160+47A>T, XM_017016064.1:c.160+47A>C, XM_017016064.1:c.160+47A>G, XM_017016064.1:c.160+47A>T, XM_017016065.1:c.160+47A>C, XM_017016065.1:c.160+47A>G, XM_017016065.1:c.160+47A>T, XR_001747082.1:n.1722+47A>C, XR_001747082.1:n.1722+47A>G, XR_001747082.1:n.1722+47A>T, XR_001747083.1:n.1070+47A>C, XR_001747083.1:n.1070+47A>G, XR_001747083.1:n.1070+47A>T, XR_001747084.1:n.1314+47A>C, XR_001747084.1:n.1314+47A>G, XR_001747084.1:n.1314+47A>T, XR_001747085.1:n.1098+47A>C, XR_001747085.1:n.1098+47A>G, XR_001747085.1:n.1098+47A>T
                  10.

                  rs782595074 [Homo sapiens]
                    GCAATGTTAATCTTTATATTCATTA[C/T]TCTTATTATTATGTATGTGGTGAAA
                    Chromosome:
                    10:47000006
                    Gene:
                    PTPN20 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by frequency
                    HGVS:
                    NC_000010.10:g.48739356T>C, NC_000010.11:g.47000006A>C, NC_000010.11:g.47000006A>T, NM_001042357.4:c.1197+32A>C, NM_001042357.4:c.1197+32A>G, NM_001042357.4:c.1197+32A>T, NM_001042358.4:c.1170+32A>C, NM_001042358.4:c.1170+32A>G, NM_001042358.4:c.1170+32A>T, NM_001042359.3:c.744+32A>C, NM_001042359.3:c.744+32A>G, NM_001042359.3:c.744+32A>T, NM_001042360.3:c.621+32A>C, NM_001042360.3:c.621+32A>G, NM_001042360.3:c.621+32A>T, NM_001042361.4:c.619+32A>C, NM_001042361.4:c.619+32A>G, NM_001042361.4:c.619+32A>T, NM_001042362.3:c.376+32A>C, NM_001042362.3:c.376+32A>G, NM_001042362.3:c.376+32A>T, NM_001042363.4:c.954+32A>C, NM_001042363.4:c.954+32A>G, NM_001042363.4:c.954+32A>T, NM_001042364.4:c.403+32A>C, NM_001042364.4:c.403+32A>G, NM_001042364.4:c.403+32A>T, NM_001042365.3:c.160+32A>C, NM_001042365.3:c.160+32A>G, NM_001042365.3:c.160+32A>T, NM_001320681.1:c.954+32A>C, NM_001320681.1:c.954+32A>G, NM_001320681.1:c.954+32A>T, NM_001320682.1:c.213+32A>C, NM_001320682.1:c.213+32A>G, NM_001320682.1:c.213+32A>T, NM_001320683.1:c.646+32A>C, NM_001320683.1:c.646+32A>G, NM_001320683.1:c.646+32A>T, NM_001320684.1:c.555+32A>C, NM_001320684.1:c.555+32A>G, NM_001320684.1:c.555+32A>T, NM_001320685.1:c.1113+32A>C, NM_001320685.1:c.1113+32A>G, NM_001320685.1:c.1113+32A>T, NM_001320686.1:c.954+32A>C, NM_001320686.1:c.954+32A>G, NM_001320686.1:c.954+32A>T, NM_001320688.1:c.528+32A>C, NM_001320688.1:c.528+32A>G, NM_001320688.1:c.528+32A>T, NM_001320689.1:c.213+32A>C, NM_001320689.1:c.213+32A>G, NM_001320689.1:c.213+32A>T, NM_001320690.1:c.213+32A>C, NM_001320690.1:c.213+32A>G, NM_001320690.1:c.213+32A>T, NM_001320691.1:c.474+32A>C, NM_001320691.1:c.474+32A>G, NM_001320691.1:c.474+32A>T, NM_015605.8:c.646+32A>C, NM_015605.8:c.646+32A>G, NM_015605.8:c.646+32A>T, XM_005270314.1:c.1197+32A>G, XM_005270315.1:c.954+32A>G, XM_005277652.1:c.954+32A>G, XM_005277653.1:c.954+32A>G, XM_011539605.2:c.1197+32A>C, XM_011539605.2:c.1197+32A>T, XM_011539606.2:c.1197+32A>C, XM_011539606.2:c.1197+32A>T, XM_011539607.2:c.1197+32A>C, XM_011539607.2:c.1197+32A>T, XM_011539610.2:c.954+32A>C, XM_011539610.2:c.954+32A>T, XM_011539611.2:c.933+32A>C, XM_011539611.2:c.933+32A>T, XM_017016042.1:c.1197+32A>C, XM_017016042.1:c.1197+32A>T, XM_017016043.1:c.1197+32A>C, XM_017016043.1:c.1197+32A>T, XM_017016044.1:c.1113+32A>C, XM_017016044.1:c.1113+32A>T, XM_017016045.1:c.1077+32A>C, XM_017016045.1:c.1077+32A>T, XM_017016046.1:c.981+32A>C, XM_017016046.1:c.981+32A>T, XM_017016047.1:c.981+32A>C, XM_017016047.1:c.981+32A>T, XM_017016048.1:c.981+32A>C, XM_017016048.1:c.981+32A>T, XM_017016049.1:c.738+32A>C, XM_017016049.1:c.738+32A>T, XM_017016050.1:c.655+32A>C, XM_017016050.1:c.655+32A>T, XM_017016051.1:c.646+32A>C, XM_017016051.1:c.646+32A>T, XM_017016052.1:c.646+32A>C, XM_017016052.1:c.646+32A>T, XM_017016053.1:c.555+32A>C, XM_017016053.1:c.555+32A>T, XM_017016054.1:c.562+32A>C, XM_017016054.1:c.562+32A>T, XM_017016055.1:c.555+32A>C, XM_017016055.1:c.555+32A>T, XM_017016056.1:c.528+32A>C, XM_017016056.1:c.528+32A>T, XM_017016057.1:c.474+32A>C, XM_017016057.1:c.474+32A>T, XM_017016058.1:c.474+32A>C, XM_017016058.1:c.474+32A>T, XM_017016059.1:c.403+32A>C, XM_017016059.1:c.403+32A>T, XM_017016060.1:c.403+32A>C, XM_017016060.1:c.403+32A>T, XM_017016061.1:c.319+32A>C, XM_017016061.1:c.319+32A>T, XM_017016062.1:c.319+32A>C, XM_017016062.1:c.319+32A>T, XM_017016063.1:c.160+32A>C, XM_017016063.1:c.160+32A>T, XM_017016064.1:c.160+32A>C, XM_017016064.1:c.160+32A>T, XM_017016065.1:c.160+32A>C, XM_017016065.1:c.160+32A>T, XR_001747082.1:n.1722+32A>C, XR_001747082.1:n.1722+32A>T, XR_001747083.1:n.1070+32A>C, XR_001747083.1:n.1070+32A>T, XR_001747084.1:n.1314+32A>C, XR_001747084.1:n.1314+32A>T, XR_001747085.1:n.1098+32A>C, XR_001747085.1:n.1098+32A>T
                    11.

                    rs782581292 [Homo sapiens]
                      TAAAAACAAAAAGCCTCATCGAAAT[-/GG]GATAGCAAATTCAACAAGATAAAAG
                      Chromosome:
                      10:46992877
                      Gene:
                      PTPN20 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by cluster
                      HGVS:
                      NC_000010.10:g.48746484_48746485insGG, NC_000010.11:g.46992877_46992878insGG, NM_001042357.4:c.1134+5322_1134+5323insCC, NM_001042357.4:c.1134+5322_1134+5323insGG, NM_001042358.4:c.1107+5322_1107+5323insCC, NM_001042358.4:c.1107+5322_1107+5323insGG, NM_001042359.3:c.681+5322_681+5323insCC, NM_001042359.3:c.681+5322_681+5323insGG, NM_001042360.3:c.558+5322_558+5323insCC, NM_001042360.3:c.558+5322_558+5323insGG, NM_001042361.4:c.557-7035_557-7034insCC, NM_001042361.4:c.557-7035_557-7034insGG, NM_001042362.3:c.314-7035_314-7034insCC, NM_001042362.3:c.314-7035_314-7034insGG, NM_001042363.4:c.891+5322_891+5323insCC, NM_001042363.4:c.891+5322_891+5323insGG, NM_001042364.4:c.341-7035_341-7034insCC, NM_001042364.4:c.341-7035_341-7034insGG, NM_001042365.3:c.98-7035_98-7034insCC, NM_001042365.3:c.98-7035_98-7034insGG, NM_001320681.1:c.891+5322_891+5323insCC, NM_001320681.1:c.891+5322_891+5323insGG, NM_001320682.1:c.151-7035_151-7034insCC, NM_001320682.1:c.151-7035_151-7034insGG, NM_001320683.1:c.584-7035_584-7034insCC, NM_001320683.1:c.584-7035_584-7034insGG, NM_001320684.1:c.493-7035_493-7034insCC, NM_001320684.1:c.493-7035_493-7034insGG, NM_001320685.1:c.1050+5322_1050+5323insCC, NM_001320685.1:c.1050+5322_1050+5323insGG, NM_001320686.1:c.891+5322_891+5323insCC, NM_001320686.1:c.891+5322_891+5323insGG, NM_001320688.1:c.465+5322_465+5323insCC, NM_001320688.1:c.465+5322_465+5323insGG, NM_001320689.1:c.151-7035_151-7034insCC, NM_001320689.1:c.151-7035_151-7034insGG, NM_001320690.1:c.151-7035_151-7034insCC, NM_001320690.1:c.151-7035_151-7034insGG, NM_001320691.1:c.411+5322_411+5323insCC, NM_001320691.1:c.411+5322_411+5323insGG, NM_015605.8:c.584-7035_584-7034insCC, NM_015605.8:c.584-7035_584-7034insGG, XM_005270314.1:c.1134+5322_1134+5323insCC, XM_005270315.1:c.891+5322_891+5323insCC, XM_005277652.1:c.891+5322_891+5323insCC, XM_005277653.1:c.891+5322_891+5323insCC, XM_011539605.2:c.1134+5322_1134+5323insGG, XM_011539606.2:c.1134+5322_1134+5323insGG, XM_011539607.2:c.1134+5322_1134+5323insGG, XM_011539610.2:c.891+5322_891+5323insGG, XM_011539611.2:c.870+5322_870+5323insGG, XM_017016042.1:c.1134+5322_1134+5323insGG, XM_017016043.1:c.1134+5322_1134+5323insGG, XM_017016044.1:c.1050+5322_1050+5323insGG, XM_017016045.1:c.1014+5322_1014+5323insGG, XM_017016046.1:c.919-7035_919-7034insGG, XM_017016047.1:c.919-7035_919-7034insGG, XM_017016048.1:c.919-7035_919-7034insGG, XM_017016049.1:c.676-7035_676-7034insGG, XM_017016050.1:c.593-7035_593-7034insGG, XM_017016051.1:c.584-7035_584-7034insGG, XM_017016052.1:c.584-7035_584-7034insGG, XM_017016053.1:c.493-7035_493-7034insGG, XM_017016054.1:c.500-7035_500-7034insGG, XM_017016055.1:c.493-7035_493-7034insGG, XM_017016056.1:c.466-7035_466-7034insGG, XM_017016057.1:c.411+5322_411+5323insGG, XM_017016058.1:c.411+5322_411+5323insGG, XM_017016059.1:c.341-7035_341-7034insGG, XM_017016060.1:c.341-7035_341-7034insGG, XM_017016061.1:c.257-7035_257-7034insGG, XM_017016062.1:c.257-7035_257-7034insGG, XM_017016063.1:c.98-7035_98-7034insGG, XM_017016064.1:c.98-7035_98-7034insGG, XM_017016065.1:c.98-7035_98-7034insGG, XR_001747082.1:n.1659+5322_1659+5323insGG, XR_001747083.1:n.1007+5322_1007+5323insGG, XR_001747084.1:n.1251+5322_1251+5323insGG, XR_001747085.1:n.1036-7035_1036-7034insGG
                      12.

                      rs782581069 [Homo sapiens]
                        TGAGACTCCATCTCAAACAAAAAAA[-/AG]AAAAAAAAAAAAAAGCTAGATATAT
                        Chromosome:
                        10:46983079
                        Gene:
                        PTPN20 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        NC_000010.10:g.48756282_48756283insAG, NC_000010.11:g.46983079_46983080insAG, NM_001042357.4:c.584-1151_584-1150insAG, NM_001042357.4:c.584-1151_584-1150insCT, NM_001042358.4:c.557-1151_557-1150insAG, NM_001042358.4:c.557-1151_557-1150insCT, NM_001042359.3:c.466-4261_466-4260insAG, NM_001042359.3:c.466-4261_466-4260insCT, NM_001042360.3:c.8-1151_8-1150insAG, NM_001042360.3:c.8-1151_8-1150insCT, NM_001042361.4:c.556+15032_556+15033insAG, NM_001042361.4:c.556+15032_556+15033insCT, NM_001042362.3:c.314-16833_314-16832insAG, NM_001042362.3:c.314-16833_314-16832insCT, NM_001042363.4:c.341-1151_341-1150insAG, NM_001042363.4:c.341-1151_341-1150insCT, NM_001042364.4:c.340+15032_340+15033insAG, NM_001042364.4:c.340+15032_340+15033insCT, NM_001042365.3:c.98-16833_98-16832insAG, NM_001042365.3:c.98-16833_98-16832insCT, NM_001320681.1:c.341-1151_341-1150insAG, NM_001320681.1:c.341-1151_341-1150insCT, NM_001320682.1:c.151-16833_151-16832insAG, NM_001320682.1:c.151-16833_151-16832insCT, NM_001320683.1:c.583+15032_583+15033insAG, NM_001320683.1:c.583+15032_583+15033insCT, NM_001320684.1:c.493-16833_493-16832insAG, NM_001320684.1:c.493-16833_493-16832insCT, NM_001320685.1:c.500-1151_500-1150insAG, NM_001320685.1:c.500-1151_500-1150insCT, NM_001320686.1:c.341-1151_341-1150insAG, NM_001320686.1:c.341-1151_341-1150insCT, NM_001320688.1:c.250-4261_250-4260insAG, NM_001320688.1:c.250-4261_250-4260insCT, NM_001320689.1:c.151-16833_151-16832insAG, NM_001320689.1:c.151-16833_151-16832insCT, NM_001320690.1:c.151-16833_151-16832insAG, NM_001320690.1:c.151-16833_151-16832insCT, NM_001320691.1:c.-140-1151_-140-1150insAG, NM_001320691.1:c.-140-1151_-140-1150insCT, NM_015605.8:c.583+15032_583+15033insAG, NM_015605.8:c.583+15032_583+15033insCT, XM_005270314.1:c.584-1151_584-1150insCT, XM_005270315.1:c.341-1151_341-1150insCT, XM_005277652.1:c.341-1151_341-1150insCT, XM_005277653.1:c.341-1151_341-1150insCT, XM_011539605.2:c.584-1151_584-1150insAG, XM_011539606.2:c.584-1151_584-1150insAG, XM_011539607.2:c.584-1151_584-1150insAG, XM_011539610.2:c.341-1151_341-1150insAG, XM_011539611.2:c.320-1151_320-1150insAG, XM_017016042.1:c.584-1151_584-1150insAG, XM_017016043.1:c.584-1151_584-1150insAG, XM_017016044.1:c.500-1151_500-1150insAG, XM_017016045.1:c.464-1151_464-1150insAG, XM_017016046.1:c.584-1151_584-1150insAG, XM_017016047.1:c.584-1151_584-1150insAG, XM_017016048.1:c.584-1151_584-1150insAG, XM_017016049.1:c.341-1151_341-1150insAG, XM_017016050.1:c.592+15032_592+15033insAG, XM_017016051.1:c.583+15032_583+15033insAG, XM_017016052.1:c.583+15032_583+15033insAG, XM_017016053.1:c.493-16833_493-16832insAG, XM_017016054.1:c.499+15032_499+15033insAG, XM_017016055.1:c.493-16833_493-16832insAG, XM_017016056.1:c.466-16833_466-16832insAG, XM_017016057.1:c.-140-1151_-140-1150insAG, XM_017016058.1:c.-140-1151_-140-1150insAG, XM_017016059.1:c.340+15032_340+15033insAG, XM_017016060.1:c.341-16833_341-16832insAG, XM_017016061.1:c.257-16833_257-16832insAG, XM_017016062.1:c.257-16833_257-16832insAG, XM_017016063.1:c.98-16833_98-16832insAG, XM_017016064.1:c.98-16833_98-16832insAG, XM_017016065.1:c.98-16833_98-16832insAG, XR_001747082.1:n.1109-1151_1109-1150insAG, XR_001747083.1:n.792-4261_792-4260insAG, XR_001747084.1:n.701-1151_701-1150insAG, XR_001747085.1:n.701-1151_701-1150insAG
                        13.

                        rs782576965 [Homo sapiens]
                          GATGTTGAACTGTAATAAGATGACA[A/C/G/T]TAATTTTGTATGATCCACATGGGGG
                          Validated:
                          no info
                          HGVS:
                          NC_000010.10:g.48739467G>A, NC_000010.10:g.48739467G>C, NC_000010.10:g.48739467G>T, NM_001042357.4:c.1135-17C>A, NM_001042357.4:c.1135-17C>G, NM_001042357.4:c.1135-17C>T, NM_001042358.4:c.1108-17C>A, NM_001042358.4:c.1108-17C>G, NM_001042358.4:c.1108-17C>T, NM_001042359.3:c.682-17C>A, NM_001042359.3:c.682-17C>G, NM_001042359.3:c.682-17C>T, NM_001042360.3:c.559-17C>A, NM_001042360.3:c.559-17C>G, NM_001042360.3:c.559-17C>T, NM_001042361.4:c.557-17C>A, NM_001042361.4:c.557-17C>G, NM_001042361.4:c.557-17C>T, NM_001042362.3:c.314-17C>A, NM_001042362.3:c.314-17C>G, NM_001042362.3:c.314-17C>T, NM_001042363.4:c.892-17C>A, NM_001042363.4:c.892-17C>G, NM_001042363.4:c.892-17C>T, NM_001042364.4:c.341-17C>A, NM_001042364.4:c.341-17C>G, NM_001042364.4:c.341-17C>T, NM_001042365.3:c.98-17C>A, NM_001042365.3:c.98-17C>G, NM_001042365.3:c.98-17C>T, NM_001320681.1:c.892-17C>A, NM_001320681.1:c.892-17C>G, NM_001320681.1:c.892-17C>T, NM_001320682.1:c.151-17C>A, NM_001320682.1:c.151-17C>G, NM_001320682.1:c.151-17C>T, NM_001320683.1:c.584-17C>A, NM_001320683.1:c.584-17C>G, NM_001320683.1:c.584-17C>T, NM_001320684.1:c.493-17C>A, NM_001320684.1:c.493-17C>G, NM_001320684.1:c.493-17C>T, NM_001320685.1:c.1051-17C>A, NM_001320685.1:c.1051-17C>G, NM_001320685.1:c.1051-17C>T, NM_001320686.1:c.892-17C>A, NM_001320686.1:c.892-17C>G, NM_001320686.1:c.892-17C>T, NM_001320688.1:c.466-17C>A, NM_001320688.1:c.466-17C>G, NM_001320688.1:c.466-17C>T, NM_001320689.1:c.151-17C>A, NM_001320689.1:c.151-17C>G, NM_001320689.1:c.151-17C>T, NM_001320690.1:c.151-17C>A, NM_001320690.1:c.151-17C>G, NM_001320690.1:c.151-17C>T, NM_001320691.1:c.412-17C>A, NM_001320691.1:c.412-17C>G, NM_001320691.1:c.412-17C>T, NM_015605.8:c.584-17C>A, NM_015605.8:c.584-17C>G, NM_015605.8:c.584-17C>T, XM_005270314.1:c.1135-17C>A, XM_005270314.1:c.1135-17C>G, XM_005270314.1:c.1135-17C>T, XM_005270315.1:c.892-17C>A, XM_005270315.1:c.892-17C>G, XM_005270315.1:c.892-17C>T, XM_005277652.1:c.892-17C>A, XM_005277652.1:c.892-17C>G, XM_005277652.1:c.892-17C>T, XM_005277653.1:c.892-17C>A, XM_005277653.1:c.892-17C>G, XM_005277653.1:c.892-17C>T
                          14.

                          rs782557812 [Homo sapiens]
                            GTTTACCATGTTTTGTTTACTGTGA[A/C]TATAAAATTCCTGCCACTAAATTTA
                            Chromosome:
                            10:46943554
                            Gene:
                            PTPN20 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            no info
                            HGVS:
                            NC_000010.10:g.48795808A>C, NC_000010.11:g.46943554T>A, NC_000010.11:g.46943554T>C, NM_001042357.4:c.130-364T>A, NM_001042357.4:c.130-364T>C, NM_001042357.4:c.130-364T>G, NM_001042358.4:c.103-364T>A, NM_001042358.4:c.103-364T>C, NM_001042358.4:c.103-364T>G, NM_001042359.3:c.103-364T>A, NM_001042359.3:c.103-364T>C, NM_001042359.3:c.103-364T>G, NM_001042360.3:c.7+31712T>A, NM_001042360.3:c.7+31712T>C, NM_001042360.3:c.7+31712T>G, NM_001042361.4:c.103-364T>A, NM_001042361.4:c.103-364T>C, NM_001042361.4:c.103-364T>G, NM_001042362.3:c.103-364T>A, NM_001042362.3:c.103-364T>C, NM_001042362.3:c.103-364T>G, NM_001042363.4:c.-114-364T>A, NM_001042363.4:c.-114-364T>C, NM_001042363.4:c.-114-364T>G, NM_001042364.4:c.-114-364T>A, NM_001042364.4:c.-114-364T>C, NM_001042364.4:c.-114-364T>G, NM_001042365.3:c.-16-3009T>A, NM_001042365.3:c.-16-3009T>C, NM_001042365.3:c.-16-3009T>G, NM_001320681.1:c.-114-364T>A, NM_001320681.1:c.-114-364T>C, NM_001320681.1:c.-114-364T>G, NM_001320682.1:c.-61-364T>A, NM_001320682.1:c.-61-364T>C, NM_001320682.1:c.-61-364T>G, NM_001320683.1:c.130-364T>A, NM_001320683.1:c.130-364T>C, NM_001320683.1:c.130-364T>G, NM_001320684.1:c.130-364T>A, NM_001320684.1:c.130-364T>C, NM_001320684.1:c.130-364T>G, NM_001320685.1:c.46-364T>A, NM_001320685.1:c.46-364T>C, NM_001320685.1:c.46-364T>G, NM_001320686.1:c.-114-364T>A, NM_001320686.1:c.-114-364T>C, NM_001320686.1:c.-114-364T>G, NM_001320688.1:c.-114-364T>A, NM_001320688.1:c.-114-364T>C, NM_001320688.1:c.-114-364T>G, NM_001320689.1:c.-61-364T>A, NM_001320689.1:c.-61-364T>C, NM_001320689.1:c.-61-364T>G, NM_001320690.1:c.-61-364T>A, NM_001320690.1:c.-61-364T>C, NM_001320690.1:c.-61-364T>G, NM_001320691.1:c.-503-364T>A, NM_001320691.1:c.-503-364T>C, NM_001320691.1:c.-503-364T>G, NM_015605.8:c.130-364T>A, NM_015605.8:c.130-364T>C, NM_015605.8:c.130-364T>G, XM_005270314.1:c.130-364T>G, XM_005270315.1:c.-114-364T>G, XM_005277652.1:c.-114-364T>G, XM_005277653.1:c.-114-364T>G, XM_011539605.2:c.130-364T>A, XM_011539605.2:c.130-364T>C, XM_011539606.2:c.130-364T>A, XM_011539606.2:c.130-364T>C, XM_011539607.2:c.130-364T>A, XM_011539607.2:c.130-364T>C, XM_011539610.2:c.-16-3009T>A, XM_011539610.2:c.-16-3009T>C, XM_017016042.1:c.130-364T>A, XM_017016042.1:c.130-364T>C, XM_017016043.1:c.130-364T>A, XM_017016043.1:c.130-364T>C, XM_017016044.1:c.46-364T>A, XM_017016044.1:c.46-364T>C, XM_017016046.1:c.130-364T>A, XM_017016046.1:c.130-364T>C, XM_017016047.1:c.130-364T>A, XM_017016047.1:c.130-364T>C, XM_017016048.1:c.130-364T>A, XM_017016048.1:c.130-364T>C, XM_017016049.1:c.-114-364T>A, XM_017016049.1:c.-114-364T>C, XM_017016050.1:c.237-3009T>A, XM_017016050.1:c.237-3009T>C, XM_017016051.1:c.130-364T>A, XM_017016051.1:c.130-364T>C, XM_017016052.1:c.130-364T>A, XM_017016052.1:c.130-364T>C, XM_017016053.1:c.130-364T>A, XM_017016053.1:c.130-364T>C, XM_017016054.1:c.46-364T>A, XM_017016054.1:c.46-364T>C, XM_017016055.1:c.130-364T>A, XM_017016055.1:c.130-364T>C, XM_017016056.1:c.103-364T>A, XM_017016056.1:c.103-364T>C, XM_017016057.1:c.-520-3009T>A, XM_017016057.1:c.-520-3009T>C, XM_017016058.1:c.-292-21432T>A, XM_017016058.1:c.-292-21432T>C, XM_017016059.1:c.-114-364T>A, XM_017016059.1:c.-114-364T>C, XM_017016060.1:c.130-364T>A, XM_017016060.1:c.130-364T>C, XM_017016061.1:c.46-364T>A, XM_017016061.1:c.46-364T>C, XM_017016062.1:c.46-364T>A, XM_017016062.1:c.46-364T>C, XM_017016063.1:c.-114-364T>A, XM_017016063.1:c.-114-364T>C, XM_017016064.1:c.-114-364T>A, XM_017016064.1:c.-114-364T>C, XM_017016065.1:c.-114-364T>A, XM_017016065.1:c.-114-364T>C, XR_001747082.1:n.338-364T>A, XR_001747082.1:n.338-364T>C, XR_001747083.1:n.338-364T>A, XR_001747083.1:n.338-364T>C, XR_001747084.1:n.338-364T>A, XR_001747084.1:n.338-364T>C, XR_001747085.1:n.338-364T>A, XR_001747085.1:n.338-364T>C
                            15.

                            rs782542724 [Homo sapiens]
                              ACTGTAATAAGATGACAGTAATTTT[C/G]TATGATCCACATGGGGGAAAAACAC
                              Chromosome:
                              10:46999887
                              Gene:
                              PTPN20 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by frequency
                              HGVS:
                              NC_000010.10:g.48739475G>C, NC_000010.11:g.46999887C>G, NM_001042357.4:c.1135-25C>G, NM_001042358.4:c.1108-25C>G, NM_001042359.3:c.682-25C>G, NM_001042360.3:c.559-25C>G, NM_001042361.4:c.557-25C>G, NM_001042362.3:c.314-25C>G, NM_001042363.4:c.892-25C>G, NM_001042364.4:c.341-25C>G, NM_001042365.3:c.98-25C>G, NM_001320681.1:c.892-25C>G, NM_001320682.1:c.151-25C>G, NM_001320683.1:c.584-25C>G, NM_001320684.1:c.493-25C>G, NM_001320685.1:c.1051-25C>G, NM_001320686.1:c.892-25C>G, NM_001320688.1:c.466-25C>G, NM_001320689.1:c.151-25C>G, NM_001320690.1:c.151-25C>G, NM_001320691.1:c.412-25C>G, NM_015605.8:c.584-25C>G, XM_005270314.1:c.1135-25C>G, XM_005270315.1:c.892-25C>G, XM_005277652.1:c.892-25C>G, XM_005277653.1:c.892-25C>G, XM_011539605.2:c.1135-25C>G, XM_011539606.2:c.1135-25C>G, XM_011539607.2:c.1135-25C>G, XM_011539610.2:c.892-25C>G, XM_011539611.2:c.871-25C>G, XM_017016042.1:c.1135-25C>G, XM_017016043.1:c.1135-25C>G, XM_017016044.1:c.1051-25C>G, XM_017016045.1:c.1015-25C>G, XM_017016046.1:c.919-25C>G, XM_017016047.1:c.919-25C>G, XM_017016048.1:c.919-25C>G, XM_017016049.1:c.676-25C>G, XM_017016050.1:c.593-25C>G, XM_017016051.1:c.584-25C>G, XM_017016052.1:c.584-25C>G, XM_017016053.1:c.493-25C>G, XM_017016054.1:c.500-25C>G, XM_017016055.1:c.493-25C>G, XM_017016056.1:c.466-25C>G, XM_017016057.1:c.412-25C>G, XM_017016058.1:c.412-25C>G, XM_017016059.1:c.341-25C>G, XM_017016060.1:c.341-25C>G, XM_017016061.1:c.257-25C>G, XM_017016062.1:c.257-25C>G, XM_017016063.1:c.98-25C>G, XM_017016064.1:c.98-25C>G, XM_017016065.1:c.98-25C>G, XR_001747082.1:n.1660-25C>G, XR_001747083.1:n.1008-25C>G, XR_001747084.1:n.1252-25C>G, XR_001747085.1:n.1036-25C>G
                              16.

                              rs782506297 [Homo sapiens]
                                TACCTTAAAGTAATGGAAACTTATG[A/T]TTACACAAAGTTTGTGAATATCTGT
                                Chromosome:
                                10:46947933
                                Gene:
                                PTPN20 (GeneView)
                                Functional Consequence:
                                intron variant,utr variant 5 prime
                                Validated:
                                no info
                                HGVS:
                                NC_000010.10:g.48791429T>A, NC_000010.11:g.46947933A>T, NM_001042357.4:c.340+1258A>T, NM_001042358.4:c.313+1258A>T, NM_001042359.3:c.313+1258A>T, NM_001042360.3:c.7+36091A>T, NM_001042361.4:c.313+1258A>T, NM_001042362.3:c.313+1258A>T, NM_001042363.4:c.97+1258A>T, NM_001042364.4:c.97+1258A>T, NM_001042365.3:c.97+1258A>T, NM_001320681.1:c.97+1258A>T, NM_001320682.1:c.150+1258A>T, NM_001320683.1:c.340+1258A>T, NM_001320684.1:c.340+1258A>T, NM_001320685.1:c.256+1258A>T, NM_001320686.1:c.97+1258A>T, NM_001320688.1:c.97+1258A>T, NM_001320689.1:c.150+1258A>T, NM_001320690.1:c.150+1258A>T, NM_001320691.1:c.-293+1258A>T, NM_015605.8:c.340+1258A>T, XM_005270314.1:c.340+1258A>T, XM_005270315.1:c.97+1258A>T, XM_005277652.1:c.97+1258A>T, XM_005277653.1:c.97+1258A>T, XM_011539605.2:c.340+1258A>T, XM_011539606.2:c.340+1258A>T, XM_011539607.2:c.340+1258A>T, XM_011539610.2:c.97+1258A>T, XM_017016042.1:c.340+1258A>T, XM_017016043.1:c.340+1258A>T, XM_017016044.1:c.256+1258A>T, XM_017016046.1:c.340+1258A>T, XM_017016047.1:c.340+1258A>T, XM_017016048.1:c.340+1258A>T, XM_017016049.1:c.97+1258A>T, XM_017016050.1:c.349+1258A>T, XM_017016051.1:c.340+1258A>T, XM_017016052.1:c.340+1258A>T, XM_017016053.1:c.340+1258A>T, XM_017016054.1:c.256+1258A>T, XM_017016055.1:c.340+1258A>T, XM_017016056.1:c.313+1258A>T, XM_017016057.1:c.-315A>T, XM_017016058.1:c.-292-17053A>T, XM_017016059.1:c.97+1258A>T, XM_017016060.1:c.340+1258A>T, XM_017016061.1:c.256+1258A>T, XM_017016062.1:c.256+1258A>T, XM_017016063.1:c.97+1258A>T, XM_017016064.1:c.97+1258A>T, XM_017016065.1:c.97+1258A>T, XR_001747082.1:n.548+1258A>T, XR_001747083.1:n.548+1258A>T, XR_001747084.1:n.548+1258A>T, XR_001747085.1:n.548+1258A>T
                                17.

                                rs782473007 [Homo sapiens]
                                  TGGTAAAGTGTTATGCAATGTTAAT[A/C]TTTATATTCATTATTCTTATTATTA
                                  Chromosome:
                                  10:47000020
                                  Gene:
                                  PTPN20 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by frequency
                                  HGVS:
                                  NC_000010.10:g.48739342C>A, NC_000010.11:g.47000020G>A, NC_000010.11:g.47000020G>C, NM_001042357.4:c.1197+46G>A, NM_001042357.4:c.1197+46G>C, NM_001042357.4:c.1197+46G>T, NM_001042358.4:c.1170+46G>A, NM_001042358.4:c.1170+46G>C, NM_001042358.4:c.1170+46G>T, NM_001042359.3:c.744+46G>A, NM_001042359.3:c.744+46G>C, NM_001042359.3:c.744+46G>T, NM_001042360.3:c.621+46G>A, NM_001042360.3:c.621+46G>C, NM_001042360.3:c.621+46G>T, NM_001042361.4:c.619+46G>A, NM_001042361.4:c.619+46G>C, NM_001042361.4:c.619+46G>T, NM_001042362.3:c.376+46G>A, NM_001042362.3:c.376+46G>C, NM_001042362.3:c.376+46G>T, NM_001042363.4:c.954+46G>A, NM_001042363.4:c.954+46G>C, NM_001042363.4:c.954+46G>T, NM_001042364.4:c.403+46G>A, NM_001042364.4:c.403+46G>C, NM_001042364.4:c.403+46G>T, NM_001042365.3:c.160+46G>A, NM_001042365.3:c.160+46G>C, NM_001042365.3:c.160+46G>T, NM_001320681.1:c.954+46G>A, NM_001320681.1:c.954+46G>C, NM_001320681.1:c.954+46G>T, NM_001320682.1:c.213+46G>A, NM_001320682.1:c.213+46G>C, NM_001320682.1:c.213+46G>T, NM_001320683.1:c.646+46G>A, NM_001320683.1:c.646+46G>C, NM_001320683.1:c.646+46G>T, NM_001320684.1:c.555+46G>A, NM_001320684.1:c.555+46G>C, NM_001320684.1:c.555+46G>T, NM_001320685.1:c.1113+46G>A, NM_001320685.1:c.1113+46G>C, NM_001320685.1:c.1113+46G>T, NM_001320686.1:c.954+46G>A, NM_001320686.1:c.954+46G>C, NM_001320686.1:c.954+46G>T, NM_001320688.1:c.528+46G>A, NM_001320688.1:c.528+46G>C, NM_001320688.1:c.528+46G>T, NM_001320689.1:c.213+46G>A, NM_001320689.1:c.213+46G>C, NM_001320689.1:c.213+46G>T, NM_001320690.1:c.213+46G>A, NM_001320690.1:c.213+46G>C, NM_001320690.1:c.213+46G>T, NM_001320691.1:c.474+46G>A, NM_001320691.1:c.474+46G>C, NM_001320691.1:c.474+46G>T, NM_015605.8:c.646+46G>A, NM_015605.8:c.646+46G>C, NM_015605.8:c.646+46G>T, XM_005270314.1:c.1197+46G>T, XM_005270315.1:c.954+46G>T, XM_005277652.1:c.954+46G>T, XM_005277653.1:c.954+46G>T, XM_011539605.2:c.1197+46G>A, XM_011539605.2:c.1197+46G>C, XM_011539606.2:c.1197+46G>A, XM_011539606.2:c.1197+46G>C, XM_011539607.2:c.1197+46G>A, XM_011539607.2:c.1197+46G>C, XM_011539610.2:c.954+46G>A, XM_011539610.2:c.954+46G>C, XM_011539611.2:c.933+46G>A, XM_011539611.2:c.933+46G>C, XM_017016042.1:c.1197+46G>A, XM_017016042.1:c.1197+46G>C, XM_017016043.1:c.1197+46G>A, XM_017016043.1:c.1197+46G>C, XM_017016044.1:c.1113+46G>A, XM_017016044.1:c.1113+46G>C, XM_017016045.1:c.1077+46G>A, XM_017016045.1:c.1077+46G>C, XM_017016046.1:c.981+46G>A, XM_017016046.1:c.981+46G>C, XM_017016047.1:c.981+46G>A, XM_017016047.1:c.981+46G>C, XM_017016048.1:c.981+46G>A, XM_017016048.1:c.981+46G>C, XM_017016049.1:c.738+46G>A, XM_017016049.1:c.738+46G>C, XM_017016050.1:c.655+46G>A, XM_017016050.1:c.655+46G>C, XM_017016051.1:c.646+46G>A, XM_017016051.1:c.646+46G>C, XM_017016052.1:c.646+46G>A, XM_017016052.1:c.646+46G>C, XM_017016053.1:c.555+46G>A, XM_017016053.1:c.555+46G>C, XM_017016054.1:c.562+46G>A, XM_017016054.1:c.562+46G>C, XM_017016055.1:c.555+46G>A, XM_017016055.1:c.555+46G>C, XM_017016056.1:c.528+46G>A, XM_017016056.1:c.528+46G>C, XM_017016057.1:c.474+46G>A, XM_017016057.1:c.474+46G>C, XM_017016058.1:c.474+46G>A, XM_017016058.1:c.474+46G>C, XM_017016059.1:c.403+46G>A, XM_017016059.1:c.403+46G>C, XM_017016060.1:c.403+46G>A, XM_017016060.1:c.403+46G>C, XM_017016061.1:c.319+46G>A, XM_017016061.1:c.319+46G>C, XM_017016062.1:c.319+46G>A, XM_017016062.1:c.319+46G>C, XM_017016063.1:c.160+46G>A, XM_017016063.1:c.160+46G>C, XM_017016064.1:c.160+46G>A, XM_017016064.1:c.160+46G>C, XM_017016065.1:c.160+46G>A, XM_017016065.1:c.160+46G>C, XR_001747082.1:n.1722+46G>A, XR_001747082.1:n.1722+46G>C, XR_001747083.1:n.1070+46G>A, XR_001747083.1:n.1070+46G>C, XR_001747084.1:n.1314+46G>A, XR_001747084.1:n.1314+46G>C, XR_001747085.1:n.1098+46G>A, XR_001747085.1:n.1098+46G>C
                                  18.

                                  rs782469769 [Homo sapiens]
                                    ATCCACAAACCACATGTTTTTACAT[A/C]TAGTATTTTTGTGTACATTCCATTC
                                    Chromosome:
                                    10:46943015
                                    Gene:
                                    PTPN20 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    no info
                                    HGVS:
                                    NC_000010.10:g.48796347C>A, NC_000010.11:g.46943015G>A, NC_000010.11:g.46943015G>C, NM_001042357.4:c.130-903G>A, NM_001042357.4:c.130-903G>C, NM_001042357.4:c.130-903G>T, NM_001042358.4:c.103-903G>A, NM_001042358.4:c.103-903G>C, NM_001042358.4:c.103-903G>T, NM_001042359.3:c.103-903G>A, NM_001042359.3:c.103-903G>C, NM_001042359.3:c.103-903G>T, NM_001042360.3:c.7+31173G>A, NM_001042360.3:c.7+31173G>C, NM_001042360.3:c.7+31173G>T, NM_001042361.4:c.103-903G>A, NM_001042361.4:c.103-903G>C, NM_001042361.4:c.103-903G>T, NM_001042362.3:c.103-903G>A, NM_001042362.3:c.103-903G>C, NM_001042362.3:c.103-903G>T, NM_001042363.4:c.-114-903G>A, NM_001042363.4:c.-114-903G>C, NM_001042363.4:c.-114-903G>T, NM_001042364.4:c.-114-903G>A, NM_001042364.4:c.-114-903G>C, NM_001042364.4:c.-114-903G>T, NM_001042365.3:c.-16-3548G>A, NM_001042365.3:c.-16-3548G>C, NM_001042365.3:c.-16-3548G>T, NM_001320681.1:c.-114-903G>A, NM_001320681.1:c.-114-903G>C, NM_001320681.1:c.-114-903G>T, NM_001320682.1:c.-61-903G>A, NM_001320682.1:c.-61-903G>C, NM_001320682.1:c.-61-903G>T, NM_001320683.1:c.130-903G>A, NM_001320683.1:c.130-903G>C, NM_001320683.1:c.130-903G>T, NM_001320684.1:c.130-903G>A, NM_001320684.1:c.130-903G>C, NM_001320684.1:c.130-903G>T, NM_001320685.1:c.46-903G>A, NM_001320685.1:c.46-903G>C, NM_001320685.1:c.46-903G>T, NM_001320686.1:c.-114-903G>A, NM_001320686.1:c.-114-903G>C, NM_001320686.1:c.-114-903G>T, NM_001320688.1:c.-114-903G>A, NM_001320688.1:c.-114-903G>C, NM_001320688.1:c.-114-903G>T, NM_001320689.1:c.-61-903G>A, NM_001320689.1:c.-61-903G>C, NM_001320689.1:c.-61-903G>T, NM_001320690.1:c.-61-903G>A, NM_001320690.1:c.-61-903G>C, NM_001320690.1:c.-61-903G>T, NM_001320691.1:c.-503-903G>A, NM_001320691.1:c.-503-903G>C, NM_001320691.1:c.-503-903G>T, NM_015605.8:c.130-903G>A, NM_015605.8:c.130-903G>C, NM_015605.8:c.130-903G>T, XM_005270314.1:c.130-903G>T, XM_005270315.1:c.-114-903G>T, XM_005277652.1:c.-114-903G>T, XM_005277653.1:c.-114-903G>T, XM_011539605.2:c.130-903G>A, XM_011539605.2:c.130-903G>C, XM_011539606.2:c.130-903G>A, XM_011539606.2:c.130-903G>C, XM_011539607.2:c.130-903G>A, XM_011539607.2:c.130-903G>C, XM_011539610.2:c.-16-3548G>A, XM_011539610.2:c.-16-3548G>C, XM_017016042.1:c.130-903G>A, XM_017016042.1:c.130-903G>C, XM_017016043.1:c.130-903G>A, XM_017016043.1:c.130-903G>C, XM_017016044.1:c.46-903G>A, XM_017016044.1:c.46-903G>C, XM_017016046.1:c.130-903G>A, XM_017016046.1:c.130-903G>C, XM_017016047.1:c.130-903G>A, XM_017016047.1:c.130-903G>C, XM_017016048.1:c.130-903G>A, XM_017016048.1:c.130-903G>C, XM_017016049.1:c.-114-903G>A, XM_017016049.1:c.-114-903G>C, XM_017016050.1:c.237-3548G>A, XM_017016050.1:c.237-3548G>C, XM_017016051.1:c.130-903G>A, XM_017016051.1:c.130-903G>C, XM_017016052.1:c.130-903G>A, XM_017016052.1:c.130-903G>C, XM_017016053.1:c.130-903G>A, XM_017016053.1:c.130-903G>C, XM_017016054.1:c.46-903G>A, XM_017016054.1:c.46-903G>C, XM_017016055.1:c.130-903G>A, XM_017016055.1:c.130-903G>C, XM_017016056.1:c.103-903G>A, XM_017016056.1:c.103-903G>C, XM_017016057.1:c.-520-3548G>A, XM_017016057.1:c.-520-3548G>C, XM_017016058.1:c.-292-21971G>A, XM_017016058.1:c.-292-21971G>C, XM_017016059.1:c.-114-903G>A, XM_017016059.1:c.-114-903G>C, XM_017016060.1:c.130-903G>A, XM_017016060.1:c.130-903G>C, XM_017016061.1:c.46-903G>A, XM_017016061.1:c.46-903G>C, XM_017016062.1:c.46-903G>A, XM_017016062.1:c.46-903G>C, XM_017016063.1:c.-114-903G>A, XM_017016063.1:c.-114-903G>C, XM_017016064.1:c.-114-903G>A, XM_017016064.1:c.-114-903G>C, XM_017016065.1:c.-114-903G>A, XM_017016065.1:c.-114-903G>C, XR_001747082.1:n.338-903G>A, XR_001747082.1:n.338-903G>C, XR_001747083.1:n.338-903G>A, XR_001747083.1:n.338-903G>C, XR_001747084.1:n.338-903G>A, XR_001747084.1:n.338-903G>C, XR_001747085.1:n.338-903G>A, XR_001747085.1:n.338-903G>C
                                    19.

                                    rs782446602 [Homo sapiens]
                                      CCATGATGTTGAACTGTAATAAGAT[A/G]ACAGTAATTTTGTATGATCCACATG
                                      Chromosome:
                                      10:46999899
                                      Gene:
                                      PTPN20 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      HGVS:
                                      NC_000010.10:g.48739463G>A, NC_000010.11:g.46999899C>A, NC_000010.11:g.46999899C>G, NM_001042357.4:c.1135-13C>A, NM_001042357.4:c.1135-13C>G, NM_001042357.4:c.1135-13C>T, NM_001042358.4:c.1108-13C>A, NM_001042358.4:c.1108-13C>G, NM_001042358.4:c.1108-13C>T, NM_001042359.3:c.682-13C>A, NM_001042359.3:c.682-13C>G, NM_001042359.3:c.682-13C>T, NM_001042360.3:c.559-13C>A, NM_001042360.3:c.559-13C>G, NM_001042360.3:c.559-13C>T, NM_001042361.4:c.557-13C>A, NM_001042361.4:c.557-13C>G, NM_001042361.4:c.557-13C>T, NM_001042362.3:c.314-13C>A, NM_001042362.3:c.314-13C>G, NM_001042362.3:c.314-13C>T, NM_001042363.4:c.892-13C>A, NM_001042363.4:c.892-13C>G, NM_001042363.4:c.892-13C>T, NM_001042364.4:c.341-13C>A, NM_001042364.4:c.341-13C>G, NM_001042364.4:c.341-13C>T, NM_001042365.3:c.98-13C>A, NM_001042365.3:c.98-13C>G, NM_001042365.3:c.98-13C>T, NM_001320681.1:c.892-13C>A, NM_001320681.1:c.892-13C>G, NM_001320681.1:c.892-13C>T, NM_001320682.1:c.151-13C>A, NM_001320682.1:c.151-13C>G, NM_001320682.1:c.151-13C>T, NM_001320683.1:c.584-13C>A, NM_001320683.1:c.584-13C>G, NM_001320683.1:c.584-13C>T, NM_001320684.1:c.493-13C>A, NM_001320684.1:c.493-13C>G, NM_001320684.1:c.493-13C>T, NM_001320685.1:c.1051-13C>A, NM_001320685.1:c.1051-13C>G, NM_001320685.1:c.1051-13C>T, NM_001320686.1:c.892-13C>A, NM_001320686.1:c.892-13C>G, NM_001320686.1:c.892-13C>T, NM_001320688.1:c.466-13C>A, NM_001320688.1:c.466-13C>G, NM_001320688.1:c.466-13C>T, NM_001320689.1:c.151-13C>A, NM_001320689.1:c.151-13C>G, NM_001320689.1:c.151-13C>T, NM_001320690.1:c.151-13C>A, NM_001320690.1:c.151-13C>G, NM_001320690.1:c.151-13C>T, NM_001320691.1:c.412-13C>A, NM_001320691.1:c.412-13C>G, NM_001320691.1:c.412-13C>T, NM_015605.8:c.584-13C>A, NM_015605.8:c.584-13C>G, NM_015605.8:c.584-13C>T, XM_005270314.1:c.1135-13C>T, XM_005270315.1:c.892-13C>T, XM_005277652.1:c.892-13C>T, XM_005277653.1:c.892-13C>T, XM_011539605.2:c.1135-13C>A, XM_011539605.2:c.1135-13C>G, XM_011539606.2:c.1135-13C>A, XM_011539606.2:c.1135-13C>G, XM_011539607.2:c.1135-13C>A, XM_011539607.2:c.1135-13C>G, XM_011539610.2:c.892-13C>A, XM_011539610.2:c.892-13C>G, XM_011539611.2:c.871-13C>A, XM_011539611.2:c.871-13C>G, XM_017016042.1:c.1135-13C>A, XM_017016042.1:c.1135-13C>G, XM_017016043.1:c.1135-13C>A, XM_017016043.1:c.1135-13C>G, XM_017016044.1:c.1051-13C>A, XM_017016044.1:c.1051-13C>G, XM_017016045.1:c.1015-13C>A, XM_017016045.1:c.1015-13C>G, XM_017016046.1:c.919-13C>A, XM_017016046.1:c.919-13C>G, XM_017016047.1:c.919-13C>A, XM_017016047.1:c.919-13C>G, XM_017016048.1:c.919-13C>A, XM_017016048.1:c.919-13C>G, XM_017016049.1:c.676-13C>A, XM_017016049.1:c.676-13C>G, XM_017016050.1:c.593-13C>A, XM_017016050.1:c.593-13C>G, XM_017016051.1:c.584-13C>A, XM_017016051.1:c.584-13C>G, XM_017016052.1:c.584-13C>A, XM_017016052.1:c.584-13C>G, XM_017016053.1:c.493-13C>A, XM_017016053.1:c.493-13C>G, XM_017016054.1:c.500-13C>A, XM_017016054.1:c.500-13C>G, XM_017016055.1:c.493-13C>A, XM_017016055.1:c.493-13C>G, XM_017016056.1:c.466-13C>A, XM_017016056.1:c.466-13C>G, XM_017016057.1:c.412-13C>A, XM_017016057.1:c.412-13C>G, XM_017016058.1:c.412-13C>A, XM_017016058.1:c.412-13C>G, XM_017016059.1:c.341-13C>A, XM_017016059.1:c.341-13C>G, XM_017016060.1:c.341-13C>A, XM_017016060.1:c.341-13C>G, XM_017016061.1:c.257-13C>A, XM_017016061.1:c.257-13C>G, XM_017016062.1:c.257-13C>A, XM_017016062.1:c.257-13C>G, XM_017016063.1:c.98-13C>A, XM_017016063.1:c.98-13C>G, XM_017016064.1:c.98-13C>A, XM_017016064.1:c.98-13C>G, XM_017016065.1:c.98-13C>A, XM_017016065.1:c.98-13C>G, XR_001747082.1:n.1660-13C>A, XR_001747082.1:n.1660-13C>G, XR_001747083.1:n.1008-13C>A, XR_001747083.1:n.1008-13C>G, XR_001747084.1:n.1252-13C>A, XR_001747084.1:n.1252-13C>G, XR_001747085.1:n.1036-13C>A, XR_001747085.1:n.1036-13C>G
                                      20.

                                      rs782422523 [Homo sapiens]
                                        GCTTGCAGTGAGCCGAGATTGCGCC[
                                        ACTGCACTCCCGCCTGGGCCACAGA
                                        GCGAGACTCCGTCTC/CCCCCCCCG
                                        GGGGCAAAAAGGGGAAACCCCTTCA
                                        AA
                                        ]AAAAAAAAAAAAAAAAAAAAAAAAG
                                        Chromosome:
                                        10:46994347
                                        Gene:
                                        PTPN20 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000010.10:g.48744976_48745015del40insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NC_000010.11:g.46994347_46994387del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NC_000010.11:g.46994347_46994387del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042357.4:c.1135-5565_1135-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001042357.4:c.1135-5565_1135-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042357.4:c.1135-5565_1135-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001042358.4:c.1108-5565_1108-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001042358.4:c.1108-5565_1108-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042358.4:c.1108-5565_1108-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001042359.3:c.682-5565_682-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001042359.3:c.682-5565_682-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042359.3:c.682-5565_682-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001042360.3:c.559-5565_559-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001042360.3:c.559-5565_559-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042360.3:c.559-5565_559-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001042361.4:c.557-5565_557-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001042361.4:c.557-5565_557-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042361.4:c.557-5565_557-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001042362.3:c.314-5565_314-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001042362.3:c.314-5565_314-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042362.3:c.314-5565_314-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001042363.4:c.892-5565_892-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001042363.4:c.892-5565_892-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042363.4:c.892-5565_892-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001042364.4:c.341-5565_341-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001042364.4:c.341-5565_341-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042364.4:c.341-5565_341-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001042365.3:c.98-5565_98-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001042365.3:c.98-5565_98-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001042365.3:c.98-5565_98-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320681.1:c.892-5565_892-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320681.1:c.892-5565_892-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320681.1:c.892-5565_892-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320682.1:c.151-5565_151-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320682.1:c.151-5565_151-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320682.1:c.151-5565_151-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320683.1:c.584-5565_584-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320683.1:c.584-5565_584-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320683.1:c.584-5565_584-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320684.1:c.493-5565_493-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320684.1:c.493-5565_493-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320684.1:c.493-5565_493-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320685.1:c.1051-5565_1051-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320685.1:c.1051-5565_1051-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320685.1:c.1051-5565_1051-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320686.1:c.892-5565_892-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320686.1:c.892-5565_892-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320686.1:c.892-5565_892-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320688.1:c.466-5565_466-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320688.1:c.466-5565_466-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320688.1:c.466-5565_466-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320689.1:c.151-5565_151-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320689.1:c.151-5565_151-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320689.1:c.151-5565_151-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320690.1:c.151-5565_151-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320690.1:c.151-5565_151-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320690.1:c.151-5565_151-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_001320691.1:c.412-5565_412-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_001320691.1:c.412-5565_412-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_001320691.1:c.412-5565_412-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, NM_015605.8:c.584-5565_584-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, NM_015605.8:c.584-5565_584-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, NM_015605.8:c.584-5565_584-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, XM_005270314.1:c.1135-5565_1135-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, XM_005270315.1:c.892-5565_892-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, XM_005277652.1:c.892-5565_892-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, XM_005277653.1:c.892-5565_892-5526del40insTTTGAAGGGGTTTCCCCTTTTTGCCCCCGGGGGGGG, XM_011539605.2:c.1135-5565_1135-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_011539605.2:c.1135-5565_1135-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_011539606.2:c.1135-5565_1135-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_011539606.2:c.1135-5565_1135-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_011539607.2:c.1135-5565_1135-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_011539607.2:c.1135-5565_1135-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_011539610.2:c.892-5565_892-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_011539610.2:c.892-5565_892-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_011539611.2:c.871-5565_871-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_011539611.2:c.871-5565_871-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016042.1:c.1135-5565_1135-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016042.1:c.1135-5565_1135-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016043.1:c.1135-5565_1135-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016043.1:c.1135-5565_1135-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016044.1:c.1051-5565_1051-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016044.1:c.1051-5565_1051-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016045.1:c.1015-5565_1015-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016045.1:c.1015-5565_1015-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016046.1:c.919-5565_919-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016046.1:c.919-5565_919-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016047.1:c.919-5565_919-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016047.1:c.919-5565_919-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016048.1:c.919-5565_919-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016048.1:c.919-5565_919-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016049.1:c.676-5565_676-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016049.1:c.676-5565_676-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016050.1:c.593-5565_593-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016050.1:c.593-5565_593-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016051.1:c.584-5565_584-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016051.1:c.584-5565_584-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016052.1:c.584-5565_584-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016052.1:c.584-5565_584-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016053.1:c.493-5565_493-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016053.1:c.493-5565_493-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016054.1:c.500-5565_500-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016054.1:c.500-5565_500-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016055.1:c.493-5565_493-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016055.1:c.493-5565_493-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016056.1:c.466-5565_466-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016056.1:c.466-5565_466-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016057.1:c.412-5565_412-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016057.1:c.412-5565_412-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016058.1:c.412-5565_412-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016058.1:c.412-5565_412-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016059.1:c.341-5565_341-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016059.1:c.341-5565_341-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016060.1:c.341-5565_341-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016060.1:c.341-5565_341-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016061.1:c.257-5565_257-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016061.1:c.257-5565_257-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016062.1:c.257-5565_257-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016062.1:c.257-5565_257-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016063.1:c.98-5565_98-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016063.1:c.98-5565_98-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016064.1:c.98-5565_98-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016064.1:c.98-5565_98-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XM_017016065.1:c.98-5565_98-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XM_017016065.1:c.98-5565_98-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XR_001747082.1:n.1660-5565_1660-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XR_001747082.1:n.1660-5565_1660-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XR_001747083.1:n.1008-5565_1008-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XR_001747083.1:n.1008-5565_1008-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XR_001747084.1:n.1252-5565_1252-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XR_001747084.1:n.1252-5565_1252-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA, XR_001747085.1:n.1036-5565_1036-5525del41insACTGCACTCCCGCCTGGGCCACAGAGCGAGACTCCGTCTC, XR_001747085.1:n.1036-5565_1036-5525del41insCCCCCCCCGGGGGCAAAAAGGGGAAACCCCTTCAAA

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center