Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 842

1.
3.
4.

rs796186800 [Homo sapiens]
    GACCATCCTGGCTAACACGTCTCTA[C/T]TAAAAATAAAAATAAAAATTAGCCG
    Chromosome:
    6:42922572
    Gene:
    PTCRA (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by frequency
    HGVS:
    NC_000006.11:g.42890310C>T, NC_000006.12:g.42922572C>T, NG_029636.1:g.11584C>T, NM_001243168.1:c.59-455C>T, NM_001243169.1:c.101+312C>T, NM_001243170.1:c.59-1657C>T, NM_138296.2:c.59-455C>T, XM_005248861.1:c.48-573C>T, XM_005248862.1:c.48-573C>T, XM_005248863.1:c.59-590C>T
    5.

    rs796082058 [Homo sapiens]
      GGGACTTTGCAGACTGAAGTGCTGT[C/T]TCTTCAGAGGGAGTGCAGGTGTCCG
      Chromosome:
      6:42915822
      Gene:
      PTCRA (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      no info
      HGVS:
      NC_000006.11:g.42883560C>T, NC_000006.12:g.42915822C>T, NG_029636.1:g.4834C>T, NM_001243168.1:c.-248C>T, NM_001243169.1:c.-248C>T, NM_001243170.1:c.-248C>T, NM_138296.2:c.-248C>T, XM_005248861.1:c.-259C>T, XM_005248862.1:c.-259C>T, XM_005248863.1:c.-248C>T
      6.
      7.

      rs781673966 [Homo sapiens]
        AAATAAAAATAAAAATTAGCCGGGC[A/G]CTGTGGCGGGCACCTGTAGTCCCAG
        Chromosome:
        6:42922601
        Gene:
        PTCRA (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        HGVS:
        NC_000006.11:g.42890339G>A, NC_000006.12:g.42922601G>A, NG_029636.1:g.11613G>A, NM_001243168.1:c.59-426G>A, NM_001243169.1:c.101+341G>A, NM_001243170.1:c.59-1628G>A, NM_138296.2:c.59-426G>A, XM_005248861.1:c.48-544G>A, XM_005248862.1:c.48-544G>A, XM_005248863.1:c.59-561G>A
        9.

        rs781603830 [Homo sapiens]
          GGAATAAGAGGCTGGGACCAGGACC[C/T]TGGGCCCGGGGGGTGGGGCCTTCAG
          Chromosome:
          6:42924323
          Gene:
          PTCRA (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          no info
          HGVS:
          NC_000006.11:g.42892061T>C, NC_000006.12:g.42924323T>C, NG_029636.1:g.13335T>C, NM_001243168.1:c.424+50T>C, NM_001243169.1:c.349+50T>C, NM_001243170.1:c.103+50T>C, NM_138296.2:c.424+50T>C, XM_005248861.1:c.295+50T>C, XM_005248862.1:c.295+50T>C, XM_005248863.1:c.289+50T>C
          10.

          rs781520236 [Homo sapiens]
            GCATCAGATGCTAATTAATTCCTGC[A/G]TGGCCCCCACCCCTACCCCCATGAT
            Chromosome:
            6:42925032
            Gene:
            PTCRA (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by cluster
            HGVS:
            NC_000006.11:g.42892770G>A, NC_000006.12:g.42925032G>A, NG_029636.1:g.14044G>A, NM_001243168.1:c.425-184G>A, NM_001243169.1:c.350-229G>A, NM_001243170.1:c.104-229G>A, NM_138296.2:c.425-229G>A, XM_005248861.1:c.296-184G>A, XM_005248862.1:c.296-229G>A, XM_005248863.1:c.290-229G>A
            11.

            rs781407368 [Homo sapiens]
              CAGAGTGCATGGCCCATCCCCAAAG[A/T]CTCATTCGCTTCTCCCTGGACAACA
              Chromosome:
              6:42924202
              Gene:
              PTCRA (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              by frequency
              HGVS:
              NC_000006.11:g.42891940A>T, NC_000006.12:g.42924202A>T, NG_029636.1:g.13214A>T, NM_001243168.1:c.380-27A>T, NM_001243169.1:c.305-27A>T, NM_001243170.1:c.59-27A>T, NM_138296.2:c.380-27A>T, XM_005248861.1:c.251-27A>T, XM_005248862.1:c.251-27A>T, XM_005248863.1:c.245-27A>T
              12.

              rs781321829 [Homo sapiens]
                GCTTACGCCTGTAATTCCAGCACTT[C/T]GGAAGGCCAAGGCGGGCAGATCACT
                Chromosome:
                6:42918013
                Gene:
                PTCRA (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by cluster
                HGVS:
                NC_000006.11:g.42885751T>C, NC_000006.12:g.42918013T>C, NG_029636.1:g.7025T>C, NM_001243168.1:c.58+1886T>C, NM_001243169.1:c.58+1886T>C, NM_001243170.1:c.58+1886T>C, NM_138296.2:c.58+1886T>C, XM_005248861.1:c.47+1886T>C, XM_005248862.1:c.47+1886T>C, XM_005248863.1:c.58+1886T>C
                13.

                rs781036234 [Homo sapiens]
                  CAGCCGCAACTCAGGTCTGCAGCTG[A/G]GTCCTGCCTCCTTCCGAGTGGGCCA
                  Chromosome:
                  6:42916045
                  Gene:
                  PTCRA (GeneView)
                  Functional Consequence:
                  utr variant 5 prime
                  Validated:
                  no info
                  HGVS:
                  NC_000006.11:g.42883783G>A, NC_000006.12:g.42916045G>A, NG_029636.1:g.5057G>A, NM_001243168.1:c.-25G>A, NM_001243169.1:c.-25G>A, NM_001243170.1:c.-25G>A, NM_138296.2:c.-25G>A, XM_005248861.1:c.-36G>A, XM_005248862.1:c.-36G>A, XM_005248863.1:c.-25G>A
                  14.

                  rs780976905 [Homo sapiens]
                    TGCGCCTGGCCCTGGGTATCTTTTT[C/G]CCTATAATAAAGCCAGCCATCTAAA
                    Chromosome:
                    6:42915577
                    Gene:
                    PTCRA (GeneView)
                    Functional Consequence:
                    upstream variant 2KB
                    Validated:
                    no info
                    HGVS:
                    NC_000006.11:g.42883315G>C, NC_000006.12:g.42915577G>C, NG_029636.1:g.4589G>C, NM_001243168.1:c.-493G>C, NM_001243169.1:c.-493G>C, NM_001243170.1:c.-493G>C, NM_138296.2:c.-493G>C, XM_005248861.1:c.-504G>C, XM_005248862.1:c.-504G>C, XM_005248863.1:c.-493G>C
                    17.

                    rs780550059 [Homo sapiens]
                      TGTACATGACACCCTATAAGGACCA[A/G]ACTAATTAACAAATCACTACCAGTT
                      Chromosome:
                      6:42923663
                      Gene:
                      PTCRA (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      HGVS:
                      NC_000006.11:g.42891401A>G, NC_000006.12:g.42923663A>G, NG_029636.1:g.12675A>G, NM_001243168.1:c.379+316A>G, NM_001243169.1:c.304+316A>G, NM_001243170.1:c.59-566A>G, NM_138296.2:c.379+316A>G, XM_005248861.1:c.250+316A>G, XM_005248862.1:c.250+316A>G, XM_005248863.1:c.244+316A>G
                      18.

                      rs780382863 [Homo sapiens]
                        TGGATGGAAAGCAGCAGATGGTGGT[C/G]GTCTGCCTGGTCCTTGATGTTGCAC
                        Chromosome:
                        6:42923103
                        Gene:
                        PTCRA (GeneView)
                        Functional Consequence:
                        intron variant,synonymous codon
                        Validated:
                        no info
                        HGVS:
                        NC_000006.11:g.42890841G>C, NC_000006.12:g.42923103G>C, NG_029636.1:g.12115G>C, NM_001243168.1:c.135G>C, NM_001243169.1:c.102-42G>C, NM_001243170.1:c.59-1126G>C, NM_138296.2:c.135G>C, NP_001230097.1:p.Val45, NP_612153.2:p.Val45, XM_005248861.1:c.48-42G>C, XM_005248862.1:c.48-42G>C, XM_005248863.1:c.59-59G>C
                        19.

                        rs780345799 [Homo sapiens]
                          GGTGCCACTGCACTCCAGTCTGGGA[A/G]ACGTAGCAAGACTCCGTCTCAAAAA
                          Chromosome:
                          6:42922004
                          Gene:
                          PTCRA (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          by frequency
                          HGVS:
                          NC_000006.11:g.42889742G>A, NC_000006.12:g.42922004G>A, NG_029636.1:g.11016G>A, NM_001243168.1:c.59-1023G>A, NM_001243169.1:c.59-214G>A, NM_001243170.1:c.59-2225G>A, NM_138296.2:c.59-1023G>A, XM_005248861.1:c.48-1141G>A, XM_005248862.1:c.48-1141G>A, XM_005248863.1:c.59-1158G>A
                          20.

                          rs780324552 [Homo sapiens]
                            AAAAGCTGGTCTAGCACCCACAGGT[A/C]CATGCTCTCTTGCAGGTGTGGGCGG
                            Chromosome:
                            6:42923011
                            Gene:
                            PTCRA (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            no info
                            HGVS:
                            NC_000006.11:g.42890749A>C, NC_000006.12:g.42923011A>C, NG_029636.1:g.12023A>C, NM_001243168.1:c.59-16A>C, NM_001243169.1:c.102-134A>C, NM_001243170.1:c.59-1218A>C, NM_138296.2:c.59-16A>C, XM_005248861.1:c.48-134A>C, XM_005248862.1:c.48-134A>C, XM_005248863.1:c.59-151A>C

                            Display Settings:

                            Format
                            Items per page
                            Sort by

                            Send to:

                            Choose Destination

                            Supplemental Content

                            Find related data

                            Recent activity

                            Your browsing activity is empty.

                            Activity recording is turned off.

                            Turn recording back on

                            See more...
                            Support Center