Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 233

1.

rs587468806 [Mus musculus]
    TATTCTAGACAAAAAAAAATAATTA[C/T]GGGAAGATATAAGAGGTGCTGCTTC
    Chromosome:
    1:131017988
    Gene:
    Il10 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    no info
    2.

    rs586318320 [Mus musculus]
      CATGTAGGGCAATCTGTCTTTAAGT[A/G]GGGATAAATTACTCTTGAATAAAAT
      Chromosome:
      1:131023866
      Gene:
      Il10 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      3.

      rs585651447 [Mus musculus]
        TTCTTTTCCTTTTTTAAACTAAATG[A/G]CCGATGTTCTGTTCTGGTTGGCATC
        Chromosome:
        1:131023573
        Gene:
        Il10 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        4.

        rs585120625 [Mus musculus]
          TCTCCTCCTTCTCTTTCTCCTCCTC[C/T]GCTTTCTCCTCCTTCTCTTCCTCCT
          Chromosome:
          1:131020195
          Gene:
          Il10 (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          no info
          5.

          rs584676346 [Mus musculus]
            AGAAGACTGCTATCCCTAAGCCAGT[A/G]TCTATGAATAATACAGTCGGGGCAT
            Chromosome:
            1:131021950
            Gene:
            Il10 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            no info
            6.

            rs584230859 [Mus musculus]
              CTAATATATTAATGTTTTATGTTAA[C/T]ATATTATGAAATAGTTTTATGTACA
              Chromosome:
              1:131017925
              Gene:
              Il10 (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              no info
              7.

              rs584109571 [Mus musculus]
                GGGGAGCGACCAAGCGATTAGGGAC[C/G]GGACGGGAGGTGCTGCTTGTGACAG
                Chromosome:
                1:131021069
                Gene:
                Il10 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                no info
                8.

                rs583605516 [Mus musculus]
                  AAGCATCAAAGCTGAAACTCTGAGA[C/G]GAAATGTTGGGGTTAAAAATGGAAG
                  Chromosome:
                  1:131025292
                  Gene:
                  Il10 (GeneView)
                  Functional Consequence:
                  downstream variant 500B
                  Validated:
                  no info
                  9.

                  rs582742195 [Mus musculus]
                    TGTTTTTCATTTATCATTGTAAAAC[C/T]GAGGACAATTTTATAACTTTTTTGT
                    Chromosome:
                    1:131023803
                    Gene:
                    Il10 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    no info
                    10.

                    rs582024338 [Mus musculus]
                      TAAAGTAACTGGTGTATGTGCACAC[A/G]CATAGTGCTCTCTCTTTCTTTTCCT
                      Chromosome:
                      1:131023532
                      Gene:
                      Il10 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      11.

                      rs581606261 [Mus musculus]
                        TCTCATGCTGGGATCTGAGCTTCTT[C/T]GTGAAACACGGGGCAGAGGAGGCAC
                        Chromosome:
                        1:131019221
                        Gene:
                        Il10 (GeneView)
                        Functional Consequence:
                        upstream variant 2KB
                        Validated:
                        no info
                        12.

                        rs579545301 [Mus musculus]
                          TCCATTAGTGGCATGCTCTTTCAGC[G/T]CTTATCTTTATATTCCAGTAAGTTA
                          Chromosome:
                          1:131023675
                          Gene:
                          Il10 (GeneView)
                          Functional Consequence:
                          intron variant
                          Validated:
                          no info
                          13.

                          rs578597186 [Mus musculus]
                            CATTCTGCATAAGCATTATATGAGC[A/T]CTGGCCTCTTAAAAAAAATTAGTTG
                            Chromosome:
                            1:131023317
                            Gene:
                            Il10 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            no info
                            14.

                            rs387648198 [Mus musculus]
                              AAACATAAAAAAAAAAAAAAAAAAA[
                              -/AAAAAAAAAA
                              ]CACCAACCATTTCCCTGCTATCTCT
                              Chromosome:
                              1:131023220
                              Gene:
                              Il10 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              no info
                              15.

                              rs387568535 [Mus musculus]
                                AGGACGTGTAGCATTGCCCCCCCCC[-/C]TTGGGTCACACAGAAAACAGGTACC
                                Chromosome:
                                1:131018869
                                Gene:
                                Il10 (GeneView)
                                Functional Consequence:
                                upstream variant 2KB
                                Validated:
                                no info
                                16.

                                rs265953156 [Mus musculus]
                                  TCTAGAGAGACGCCTGTCCGGTGTC[A/G]GGTCTCTTGCTCATCTGTCTCTGAG
                                  Chromosome:
                                  1:131021636
                                  Gene:
                                  Il10 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  no info
                                  17.

                                  rs265842707 [Mus musculus]
                                    CCTTCTATAGGCCAGATTCAGTTCT[-/GGGGGG]GGGGGGGTCAGACACACAAAGCTAA
                                    Chromosome:
                                    1:131018146
                                    Gene:
                                    Il10 (GeneView)
                                    Functional Consequence:
                                    upstream variant 2KB
                                    Validated:
                                    no info
                                    18.

                                    rs265259814 [Mus musculus]
                                      TACCAATGCTCTCTTTTTTCTTCTT[C/T]AGCATCGATTTCTCCCCTGTGAAAA
                                      Chromosome:
                                      1:131022486
                                      Gene:
                                      Il10 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      no info
                                      19.

                                      rs264932092 [Mus musculus]
                                        GTAACTGAGTGCTAAGGTGACTTCC[A/G]AGTCAGCAAGAAATATCGGACGTTC
                                        Chromosome:
                                        1:131019398
                                        Gene:
                                        Il10 (GeneView)
                                        Functional Consequence:
                                        upstream variant 2KB
                                        Validated:
                                        no info
                                        20.

                                        rs264743260 [Mus musculus]
                                          AATAAATGGATCTTATTCGAATTAC[A/G]GTGTGGTGTCTATTGAGTTCTGTCT
                                          Chromosome:
                                          1:131024977
                                          Gene:
                                          Il10 (GeneView)
                                          Functional Consequence:
                                          downstream variant 500B
                                          Validated:
                                          no info

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center