Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 142

1.

rs587551432 [Mus musculus]
    AGTTTATGCACTTCCTACCAGAGGT[A/G]TAGAGGCACCTGAAAAAAAAGTATG
    Chromosome:
    7:141195566
    Gene:
    Hras (GeneView) Lrrc56 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    no info
    2.

    rs579450805 [Mus musculus]
      TGGTTAGCTGGGCAGGGTACCAGGT[A/G]CTGTCCCAAGTACTAAGCCCATGCC
      Chromosome:
      7:141189484
      Gene:
      Hras (GeneView)
      Functional Consequence:
      downstream variant 500B
      Validated:
      no info
      3.

      rs265897718 [Mus musculus]
        CTATCTCCCACCCACCTTAAGTTCA[A/T]GACCAACAAGGCTCCGAAGGTGTCA
        Chromosome:
        7:141189997
        Gene:
        Hras (GeneView)
        Functional Consequence:
        utr variant 3 prime
        Validated:
        no info
        4.

        rs264956370 [Mus musculus]
          GATCTAGGGCCAAACACAGACCTCT[A/G]TATCTTTAAGGAGAAACAGTTTATG
          Chromosome:
          7:141195523
          Gene:
          Hras (GeneView) Lrrc56 (GeneView)
          Functional Consequence:
          intron variant,upstream variant 2KB
          Validated:
          no info
          5.

          rs263322127 [Mus musculus]
            CTAACTAGAGAAATGTATCTGGGAA[C/T]GGCAGGAAGTACAGGAGTTAGGGGT
            Chromosome:
            7:141195370
            Gene:
            Hras (GeneView) Lrrc56 (GeneView)
            Functional Consequence:
            intron variant,upstream variant 2KB
            Validated:
            no info
            6.

            rs262774187 [Mus musculus]
              TGGGGGTGGGGGGTGGGGGTGGGGT[-/C]CTCACCTCTCCTCAGACCAGAGAAT
              Chromosome:
              7:141192666
              Gene:
              Hras (GeneView) Lrrc56 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              no info
              7.

              rs262761096 [Mus musculus]
                CTGTGGAAGAGAGCAACTGTGGTGT[C/T]GCACTGCCCAGCCACTCAGCAGCAG
                Chromosome:
                7:141190116
                Gene:
                Hras (GeneView)
                Functional Consequence:
                utr variant 3 prime
                Validated:
                no info
                8.

                rs261517728 [Mus musculus]
                  AAGCCCTCACCTGAGAGAGCGACCG[C/G]CGCGGTGGAGGGGCCTAGTGCTGCG
                  Chromosome:
                  7:141195157
                  Gene:
                  Hras (GeneView) Lrrc56 (GeneView)
                  Functional Consequence:
                  intron variant,upstream variant 2KB,utr variant 5 prime
                  Validated:
                  no info
                  9.

                  rs260348883 [Mus musculus]
                    CTCCGCCCCACGCCCGTCCGTCAAC[C/T]CGAGGCGGCCCGTGATTGGTCGAAC
                    Chromosome:
                    7:141194040
                    Gene:
                    Hras (GeneView) Lrrc56 (GeneView)
                    Functional Consequence:
                    upstream variant 2KB
                    Validated:
                    no info
                    10.

                    rs259053120 [Mus musculus]
                      CCTACCAGAGGTGTAGAGGCACCTG[-/A]AAAAAAAAGTATGGGAAGGAGTGCC
                      Chromosome:
                      7:141195578
                      Gene:
                      Hras (GeneView) Lrrc56 (GeneView)
                      Functional Consequence:
                      intron variant,upstream variant 2KB
                      Validated:
                      no info
                      11.

                      rs258625830 [Mus musculus]
                        ACTGCCACAGCCCACCTCTGGCAGG[A/T]AGGCAGAGCTCACCTCTATAGTGGG
                        Chromosome:
                        7:141192816
                        Gene:
                        Hras (GeneView) Lrrc56 (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Validated:
                        no info
                        12.

                        rs258138019 [Mus musculus]
                          GATGGACCCTCCTGTAGCCATGACT[A/T]GAGCCAGAAGGAAGCACGCAGTGAG
                          Chromosome:
                          7:141190309
                          Gene:
                          Hras (GeneView)
                          Functional Consequence:
                          utr variant 3 prime
                          Validated:
                          no info
                          13.

                          rs255833645 [Mus musculus]
                            TGAGATGTAGTAGCCTCAACAGGAC[A/G]GACCTGGGCACAGGCAGGACATGGA
                            Chromosome:
                            7:141189590
                            Gene:
                            Hras (GeneView)
                            Functional Consequence:
                            downstream variant 500B
                            Validated:
                            no info
                            14.

                            rs255023965 [Mus musculus]
                              CATGTCTTTATTTGCATTGGGTGAC[C/T]AAGAGGGACCCTGGCTGAATCCTCA
                              Chromosome:
                              7:141195707
                              Gene:
                              Hras (GeneView) Lrrc56 (GeneView)
                              Functional Consequence:
                              intron variant,upstream variant 2KB
                              Validated:
                              no info
                              15.

                              rs254842643 [Mus musculus]
                                GCAGTGAGCAGCCATCTGACCTGCA[C/T]GTGCCTCTCAAGGCCATACAGGTGA
                                Chromosome:
                                7:141190352
                                Gene:
                                Hras (GeneView)
                                Functional Consequence:
                                utr variant 3 prime
                                Validated:
                                no info
                                16.

                                rs254440666 [Mus musculus]
                                  AGGGCTGCAGGATGTTGGGTCAGGG[
                                  -/CAAATCTTA
                                  ]CACTCTGTCACTCTTGAGGCTGTAT
                                  Chromosome:
                                  7:141190573
                                  Gene:
                                  Hras (GeneView)
                                  Functional Consequence:
                                  cds indel,downstream variant 500B
                                  Validated:
                                  no info
                                  17.

                                  rs253442536 [Mus musculus]
                                    AGCCTGCTAAAACTCTCAAACAGGG[C/T]CAGGGACAACTCCTAGTGTAGCAGA
                                    Chromosome:
                                    7:141189944
                                    Gene:
                                    Hras (GeneView)
                                    Functional Consequence:
                                    utr variant 3 prime
                                    Validated:
                                    no info
                                    18.

                                    rs253326229 [Mus musculus]
                                      CTCTTGAGGCTGTATTTCATGGATC[C/T]CAGAATGCAGGAAATGTGTTTCCTG
                                      Chromosome:
                                      7:141190617
                                      Gene:
                                      Hras (GeneView)
                                      Functional Consequence:
                                      downstream variant 500B,utr variant 3 prime
                                      Validated:
                                      no info
                                      19.

                                      rs252082191 [Mus musculus]
                                        GGACAAGACATACAGGACAGAGTAA[G/T]CAATAAGTCATGAAGTGCAGTGGAA
                                        Chromosome:
                                        7:141195309
                                        Gene:
                                        Hras (GeneView) Lrrc56 (GeneView)
                                        Functional Consequence:
                                        intron variant,upstream variant 2KB
                                        Validated:
                                        no info
                                        20.

                                        rs251186793 [Mus musculus]
                                          TCCTGCAAAACAACACGGCTTAGTG[G/T]GGGTGGGGGGTGGGGGTGGGGTCTC
                                          Chromosome:
                                          7:141192644
                                          Gene:
                                          Hras (GeneView) Lrrc56 (GeneView)
                                          Functional Consequence:
                                          intron variant,upstream variant 2KB
                                          Validated:
                                          no info

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center