Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 11682

2.
3.

rs796954533 [Homo sapiens]
    GTGTGTGTGTGTGTGTGTGTGTCTG[-/TGTGTGTC]TGTGTGTCTGTGTATCATATGGCAC
    Chromosome:
    3:179968726
    Gene:
    PEX5L (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    HGVS:
    NC_000003.11:g.179686514_179686521delTGTGTGTC, NC_000003.12:g.179968726_179968733delTGTGTGTC, NM_001256750.1:c.21+67846_21+67853delGACACACA, NM_001256751.1:c.21+67846_21+67853delGACACACA, NM_001256752.1:c.93+2861_93+2868delGACACACA, NM_001256753.1:c.21+67846_21+67853delGACACACA, NM_001256754.1:c.-37+2861_-37+2868delGACACACA, NM_001256755.1:c.-37+2861_-37+2868delGACACACA, NM_001256756.1:c.-379+2861_-379+2868delGACACACA, NM_016559.2:c.93+2861_93+2868delGACACACA, XM_005247523.1:c.165+2861_165+2868delGACACACA, XM_005247524.1:c.165+2861_165+2868delGACACACA, XM_005247525.1:c.165+2861_165+2868delGACACACA, XM_011512882.2:c.258+2861_258+2868delGACACACA, XM_011512884.2:c.165+2861_165+2868delGACACACA, XM_011512885.2:c.93+2861_93+2868delGACACACA, XM_011512886.2:c.258+2861_258+2868delGACACACA, XM_011512887.2:c.-103+2861_-103+2868delGACACACA, XM_017006601.1:c.258+2861_258+2868delGACACACA, XM_017006602.1:c.165+2861_165+2868delGACACACA, XM_017006603.1:c.165+2861_165+2868delGACACACA, XM_017006604.1:c.165+2861_165+2868delGACACACA, XM_017006605.1:c.21+67846_21+67853delGACACACA, XM_017006606.1:c.-372+2861_-372+2868delGACACACA, XM_017006607.1:c.-372+2861_-372+2868delGACACACA, XM_017006608.1:c.-372+2861_-372+2868delGACACACA, XM_017006609.1:c.-372+2861_-372+2868delGACACACA, XM_017006610.1:c.-372+67846_-372+67853delGACACACA, XM_017006611.1:c.-184+2861_-184+2868delGACACACA
    4.

    rs796946971 [Homo sapiens]
      ACTTACTTACTTACCTACCCTACCC[-/ACCT]ACCTACCTACCTACCCACCAACCTA
      Chromosome:
      3:179832838
      Gene:
      PEX5L (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      HGVS:
      NC_000003.11:g.179550626_179550627insACCT, NC_000003.12:g.179832838_179832839insACCT, NM_001256750.1:c.817-12863_817-12862insAGGT, NM_001256751.1:c.751-12863_751-12862insAGGT, NM_001256752.1:c.718-12863_718-12862insAGGT, NM_001256753.1:c.646-12863_646-12862insAGGT, NM_001256754.1:c.694-12863_694-12862insAGGT, NM_001256755.1:c.499-12863_499-12862insAGGT, NM_001256756.1:c.247-12863_247-12862insAGGT, NM_016559.2:c.823-12863_823-12862insAGGT, XM_005247523.1:c.961-12863_961-12862insAGGT, XM_005247524.1:c.895-12863_895-12862insAGGT, XM_005247525.1:c.790-12863_790-12862insAGGT, XM_005247526.1:c.487-12863_487-12862insAGGT, XM_011512882.2:c.988-12863_988-12862insAGGT, XM_011512884.2:c.895-12863_895-12862insAGGT, XM_011512885.2:c.889-12863_889-12862insAGGT, XM_011512886.2:c.883-12863_883-12862insAGGT, XM_011512887.2:c.499-12863_499-12862insAGGT, XM_011512888.2:c.733-12863_733-12862insAGGT, XM_011512891.2:c.247-12863_247-12862insAGGT, XM_011512892.2:c.247-12863_247-12862insAGGT, XM_017006601.1:c.793-12863_793-12862insAGGT, XM_017006602.1:c.790-12863_790-12862insAGGT, XM_017006603.1:c.700-12863_700-12862insAGGT, XM_017006604.1:c.595-12863_595-12862insAGGT, XM_017006605.1:c.556-12863_556-12862insAGGT, XM_017006606.1:c.247-12863_247-12862insAGGT, XM_017006607.1:c.247-12863_247-12862insAGGT, XM_017006608.1:c.247-12863_247-12862insAGGT, XM_017006609.1:c.247-12863_247-12862insAGGT, XM_017006610.1:c.247-12863_247-12862insAGGT, XM_017006611.1:c.247-12863_247-12862insAGGT
      5.

      rs796910793 [Homo sapiens]
        AGAAAGGAAAGAAAGAAGATTGGCT[-/A]AAAAAAAAATCCTCTACATTATCTA
        Chromosome:
        3:179914950
        Gene:
        PEX5L-AS2 (GeneView) PEX5L (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        HGVS:
        NC_000003.11:g.179632738_179632739insA, NC_000003.12:g.179914950_179914951insA, NM_001256750.1:c.22-14216_22-14215insT, NM_001256751.1:c.22-16705_22-16704insT, NM_001256752.1:c.94-27167_94-27166insT, NM_001256753.1:c.22-27167_22-27166insT, NM_001256754.1:c.-36-16705_-36-16704insT, NM_001256755.1:c.-36-16705_-36-16704insT, NM_001256756.1:c.-378-27167_-378-27166insT, NM_016559.2:c.94-16705_94-16704insT, NR_110059.1:n.320-6600_320-6599insA, NR_110060.1:n.203-6600_203-6599insA, NR_110061.1:n.257-6600_257-6599insA, XM_005247523.1:c.166-14216_166-14215insT, XM_005247524.1:c.166-16705_166-16704insT, XM_005247525.1:c.166-27167_166-27166insT, XM_011512882.2:c.259-16705_259-16704insT, XM_011512884.2:c.166-16705_166-16704insT, XM_011512885.2:c.94-14216_94-14215insT, XM_011512886.2:c.259-27167_259-27166insT, XM_011512887.2:c.-102-14216_-102-14215insT, XM_017006601.1:c.259-16705_259-16704insT, XM_017006602.1:c.166-27167_166-27166insT, XM_017006603.1:c.166-16705_166-16704insT, XM_017006604.1:c.166-27167_166-27166insT, XM_017006605.1:c.22-16705_22-16704insT, XM_017006606.1:c.-371-16705_-371-16704insT, XM_017006607.1:c.-371-16705_-371-16704insT, XM_017006608.1:c.-371-16705_-371-16704insT, XM_017006609.1:c.-371-16705_-371-16704insT, XM_017006610.1:c.-371-16705_-371-16704insT, XM_017006611.1:c.-183-27167_-183-27166insT, XR_241621.1:n.320-6600_320-6599insA, XR_241622.1:n.216-6600_216-6599insA, XR_241623.1:n.203-6600_203-6599insA, XR_241624.1:n.192-6600_192-6599insA
        6.
        8.
        10.

        rs796846724 [Homo sapiens]
          ATTACAGAGTTTTGGGCAAAACAAA[-/TAT]TGTTGTTTTAAGCCACAGGTGTTGG
          Chromosome:
          3:179827560
          Gene:
          PEX5L (GeneView)
          Functional Consequence:
          intron variant
          Validated:
          by frequency
          HGVS:
          NC_000003.11:g.179545348_179545350delTAT, NC_000003.12:g.179827560_179827562delTAT, NM_001256750.1:c.817-7586_817-7584delATA, NM_001256751.1:c.751-7586_751-7584delATA, NM_001256752.1:c.718-7586_718-7584delATA, NM_001256753.1:c.646-7586_646-7584delATA, NM_001256754.1:c.694-7586_694-7584delATA, NM_001256755.1:c.499-7586_499-7584delATA, NM_001256756.1:c.247-7586_247-7584delATA, NM_016559.2:c.823-7586_823-7584delATA, XM_005247523.1:c.961-7586_961-7584delATA, XM_005247524.1:c.895-7586_895-7584delATA, XM_005247525.1:c.790-7586_790-7584delATA, XM_005247526.1:c.487-7586_487-7584delATA, XM_011512882.2:c.988-7586_988-7584delATA, XM_011512884.2:c.895-7586_895-7584delATA, XM_011512885.2:c.889-7586_889-7584delATA, XM_011512886.2:c.883-7586_883-7584delATA, XM_011512887.2:c.499-7586_499-7584delATA, XM_011512888.2:c.733-7586_733-7584delATA, XM_011512891.2:c.247-7586_247-7584delATA, XM_011512892.2:c.247-7586_247-7584delATA, XM_017006601.1:c.793-7586_793-7584delATA, XM_017006602.1:c.790-7586_790-7584delATA, XM_017006603.1:c.700-7586_700-7584delATA, XM_017006604.1:c.595-7586_595-7584delATA, XM_017006605.1:c.556-7586_556-7584delATA, XM_017006606.1:c.247-7586_247-7584delATA, XM_017006607.1:c.247-7586_247-7584delATA, XM_017006608.1:c.247-7586_247-7584delATA, XM_017006609.1:c.247-7586_247-7584delATA, XM_017006610.1:c.247-7586_247-7584delATA, XM_017006611.1:c.247-7586_247-7584delATA
          15.

          rs796700962 [Homo sapiens]
            GGGTGACAGAGAGAGACTCTGTCTC[-/A]AAAAAAACAAAAAAAACTATGATAG
            Chromosome:
            3:179846169
            Gene:
            PEX5L (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by frequency
            HGVS:
            NC_000003.11:g.179563957_179563958insA, NC_000003.12:g.179846169_179846170insA, NM_001256750.1:c.816+12892_816+12893insT, NM_001256751.1:c.750+12892_750+12893insT, NM_001256752.1:c.717+12892_717+12893insT, NM_001256753.1:c.645+12892_645+12893insT, NM_001256754.1:c.693+12892_693+12893insT, NM_001256755.1:c.498+12892_498+12893insT, NM_001256756.1:c.246+12892_246+12893insT, NM_016559.2:c.822+12892_822+12893insT, XM_005247523.1:c.960+12892_960+12893insT, XM_005247524.1:c.894+12892_894+12893insT, XM_005247525.1:c.789+12892_789+12893insT, XM_005247526.1:c.486+12892_486+12893insT, XM_011512882.2:c.987+12892_987+12893insT, XM_011512884.2:c.894+12892_894+12893insT, XM_011512885.2:c.888+12892_888+12893insT, XM_011512886.2:c.882+12892_882+12893insT, XM_011512887.2:c.498+12892_498+12893insT, XM_011512888.2:c.732+12892_732+12893insT, XM_011512891.2:c.246+12892_246+12893insT, XM_011512892.2:c.246+12892_246+12893insT, XM_017006601.1:c.792+12892_792+12893insT, XM_017006602.1:c.789+12892_789+12893insT, XM_017006603.1:c.699+12892_699+12893insT, XM_017006604.1:c.594+12892_594+12893insT, XM_017006605.1:c.555+12892_555+12893insT, XM_017006606.1:c.246+12892_246+12893insT, XM_017006607.1:c.246+12892_246+12893insT, XM_017006608.1:c.246+12892_246+12893insT, XM_017006609.1:c.246+12892_246+12893insT, XM_017006610.1:c.246+12892_246+12893insT, XM_017006611.1:c.246+12892_246+12893insT
            20.

            rs796623144 [Homo sapiens]
              CTAGGTCATAAAACTGTTTCTCTTT[
              AAAAACAT/TTGA
              ]TTTTGTTTTCTGTTATCAACTGCTT
              Chromosome:
              3:179930230
              Gene:
              PEX5L (GeneView)
              Functional Consequence:
              intron variant
              Validated:
              no info
              HGVS:
              NC_000003.11:g.179648018_179648021delTTGAinsAAAAACAT, NC_000003.12:g.179930230_179930233delTTGAinsAAAAACAT, NM_001256750.1:c.22-29498_22-29495delTCAAinsATGTTTTT, NM_001256751.1:c.22-31987_22-31984delTCAAinsATGTTTTT, NM_001256752.1:c.93+41361_93+41364delTCAAinsATGTTTTT, NM_001256753.1:c.22-42449_22-42446delTCAAinsATGTTTTT, NM_001256754.1:c.-36-31987_-36-31984delTCAAinsATGTTTTT, NM_001256755.1:c.-36-31987_-36-31984delTCAAinsATGTTTTT, NM_001256756.1:c.-379+41361_-379+41364delTCAAinsATGTTTTT, NM_016559.2:c.94-31987_94-31984delTCAAinsATGTTTTT, XM_005247523.1:c.166-29498_166-29495delTCAAinsATGTTTTT, XM_005247524.1:c.166-31987_166-31984delTCAAinsATGTTTTT, XM_005247525.1:c.165+41361_165+41364delTCAAinsATGTTTTT, XM_011512882.2:c.259-31987_259-31984delTCAAinsATGTTTTT, XM_011512884.2:c.166-31987_166-31984delTCAAinsATGTTTTT, XM_011512885.2:c.94-29498_94-29495delTCAAinsATGTTTTT, XM_011512886.2:c.258+41361_258+41364delTCAAinsATGTTTTT, XM_011512887.2:c.-102-29498_-102-29495delTCAAinsATGTTTTT, XM_017006601.1:c.259-31987_259-31984delTCAAinsATGTTTTT, XM_017006602.1:c.165+41361_165+41364delTCAAinsATGTTTTT, XM_017006603.1:c.166-31987_166-31984delTCAAinsATGTTTTT, XM_017006604.1:c.165+41361_165+41364delTCAAinsATGTTTTT, XM_017006605.1:c.22-31987_22-31984delTCAAinsATGTTTTT, XM_017006606.1:c.-371-31987_-371-31984delTCAAinsATGTTTTT, XM_017006607.1:c.-371-31987_-371-31984delTCAAinsATGTTTTT, XM_017006608.1:c.-371-31987_-371-31984delTCAAinsATGTTTTT, XM_017006609.1:c.-371-31987_-371-31984delTCAAinsATGTTTTT, XM_017006610.1:c.-371-31987_-371-31984delTCAAinsATGTTTTT, XM_017006611.1:c.-184+41361_-184+41364delTCAAinsATGTTTTT

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center