Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 156

1.

rs864307674 [Mus musculus]
    TGTGTTCATGGGTTTGAGGGGGTGG[C/G/T]GGTAGGAGTGAGAGCTTCAAGTCTC
    Chromosome:
    17:85622613
    Gene:
    Six3 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    2.

    rs587317825 [Mus musculus]
      GAGTGTTAGTGTGTTCATGGGTTTG[A/G]GGGGGTGGTGGTAGGAGTGAGAGCT
      Chromosome:
      17:85622604
      Gene:
      Six3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      no info
      3.

      rs584648843 [Mus musculus]
        ACTTCTTTGAGCAAGAGGAGGAGGA[A/G]GAGGAGAGAGAAAGAGAGAGAGAGA
        Chromosome:
        17:85620518
        Gene:
        Six3 (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Validated:
        no info
        4.

        rs584342975 [Mus musculus]
          CCAACAACACCAGGGGTTTTACGCG[A/G]GCCGCCCTGGGTAGAGGGTCTGACT
          Chromosome:
          17:85626268
          Gene:
          Six3 (GeneView)
          Functional Consequence:
          downstream variant 500B
          Validated:
          no info
          5.

          rs584184298 [Mus musculus]
            CCTTCCCTCCTGTCTTCTCTTTCTA[C/T]CCTTTTCTCCCCCCCCCCCCCCCAT
            Chromosome:
            17:85623127
            Gene:
            Six3 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            no info
            6.

            rs581808798 [Mus musculus]
              ACTCCTCGGCCCTTTAAAACCTGGC[A/C]CTGTCGGATCAAGGCCTAAGAAAGA
              Chromosome:
              17:85619077
              Gene:
              Six3 (GeneView) Six3os1 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB
              Validated:
              no info
              7.

              rs581682697 [Mus musculus]
                CTCGCTGGCCGCCAGAGCCAGAGCC[G/T]GGGAGGGGGAAGGATGCCAAATGTG
                Chromosome:
                17:85625332
                Gene:
                Six3 (GeneView)
                Functional Consequence:
                downstream variant 500B,utr variant 3 prime
                Validated:
                no info
                8.

                rs581092336 [Mus musculus]
                  TAGTGTGTTCATGGGTTTGAGGGGG[G/T]GGTGGTAGGAGTGAGAGCTTCAAGT
                  Chromosome:
                  17:85622610
                  Gene:
                  Six3 (GeneView)
                  Functional Consequence:
                  intron variant
                  Validated:
                  no info
                  9.

                  rs579231313 [Mus musculus]
                    GCCTTTCAACCCAAAGAAATGGCTG[C/T]CTTGGTATAAACAATGTGGATGGTC
                    Chromosome:
                    17:85626598
                    Gene:
                    Six3 (GeneView)
                    Functional Consequence:
                    downstream variant 500B
                    Validated:
                    no info
                    10.

                    rs578784652 [Mus musculus]
                      GGGAGTCTGCCCTTCATCTGAGGCC[G/T]TCCTTCCATCTGGAACGCTTCCCTG
                      Chromosome:
                      17:85623460
                      Gene:
                      Six3 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      11.

                      rs387859972 [Mus musculus]
                        TCTGTGCACCGCAAAAGGGGGGGGG[-/G]CTTGGTTTAGAGGCGTCCATAGGAG
                        Chromosome:
                        17:85622443
                        Gene:
                        Six3 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        12.

                        rs387845178 [Mus musculus]
                          GAGAGAGAGAGAGAGAGAGAGAGAG[-/AGAGAGAG]GATATTAAGAGTTGCAAAGATTTTT
                          Chromosome:
                          17:85620576
                          Gene:
                          Six3 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          no info
                          13.

                          rs387546847 [Mus musculus]
                            GCTTTGCTCAAGAAGGGCTTTTTTT[-/T]ATCAGAGCCAGCGCTGTGTGAGCAT
                            Chromosome:
                            17:85622267
                            Gene:
                            Six3 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            no info
                            14.

                            rs387512221 [Mus musculus]
                              GAATTTGTTGTTTAAAAAAAAAAAA[-/A]GGAAAGAAAGATAGGAAAAAACTCC
                              Chromosome:
                              17:85624495
                              Gene:
                              Six3 (GeneView)
                              Functional Consequence:
                              utr variant 3 prime
                              Validated:
                              no info
                              15.

                              rs387471516 [Mus musculus]
                                CTAGGCTCCCCCAGCAGCTTGCTAC[-/C]GGTGACTATGCAGTGAGCCTCGTCA
                                Chromosome:
                                17:85620248
                                Gene:
                                Six3 (GeneView) Six3os1 (GeneView)
                                Functional Consequence:
                                intron variant,upstream variant 2KB
                                Validated:
                                no info
                                16.

                                rs387200409 [Mus musculus]
                                  AAAACAAAAACAAAAACAAAAAAAA[-/AA]CACCACCACCGCCGCTGCGACAAGA
                                  Chromosome:
                                  17:85624399
                                  Gene:
                                  Six3 (GeneView)
                                  Functional Consequence:
                                  utr variant 3 prime
                                  Validated:
                                  no info
                                  17.

                                  rs387184140 [Mus musculus]
                                    CTCTCCCTCTCTCTGCCTCGGGCTC[
                                    -/GCGCTCTCTCTCTCTCTCTCTCT
                                    CTC
                                    ]TCTCTCTCTCTCTCTCTCTCTCTCT
                                    Chromosome:
                                    17:85620919
                                    Gene:
                                    Six3 (GeneView)
                                    Functional Consequence:
                                    intron variant,utr variant 5 prime
                                    Validated:
                                    no info
                                    18.

                                    rs386850068 [Mus musculus]
                                      TCTCTCTCTCTCTCTCTCTCTCTCT[
                                      -/CTCTCTCTCTCT
                                      ]GTTTTTAAGTCCAAGTATTGGTCAA
                                      Chromosome:
                                      17:85624618
                                      Gene:
                                      Six3 (GeneView)
                                      Functional Consequence:
                                      cds indel
                                      Validated:
                                      no info
                                      19.

                                      rs265651855 [Mus musculus]
                                        ATATACTGCTTTGCTCAAGAAGGGC[-/T]TTTTTTATCAGAGCCAGCGCTGTGT
                                        Chromosome:
                                        17:85622261
                                        Gene:
                                        Six3 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        no info
                                        20.

                                        rs265593923 [Mus musculus]
                                          GCAGGAGGCTGGTTTGGGAGTCTGC[C/T]CTTCATCTGAGGCCTTCCTTCCATC
                                          Chromosome:
                                          17:85623445
                                          Gene:
                                          Six3 (GeneView)
                                          Functional Consequence:
                                          intron variant
                                          Validated:
                                          no info

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center